Short-chain fatty acid–mediated effects on erythropoiesis in primary definitive erythroid cells

Abstract

IntroductionThe human ␤-and ␣-globin gene loci are developmentally regulated and are arrayed spatially in the order in which they are expressed developmentally, respectively, 5Ј-⑀-G ␥-A ␥-␤-3Ј and 5Ј--␣-␣-3Ј. Fetal hemoglobin (HbF), an ␣ 2 ␥ 2 -tetramer, predominates from week 8 of gestation through birth, after which it is gradually superseded by adult hemoglobin (HbA), an ␣ 2 ␤ 2 -tetramer. HbF is detectable, at approximately 1%, during adult life. The molecular mechanisms underlying the ␥-to ␤-globin switch during development are not fully understood, but are of compelling interest because a persistence of HbF in adults, whether genetic or pharmacologic in origin, is ameliorative in adult ␤-globin gene disorders such as sickle cell anemia or ␤-thalassemia. 1,2 Intermediaries of mammalian metabolism, such as the shortchain fatty acids (SCFAs) butyrate and propionate, are important fuels during fetal life and, when elevated, are implicated in the delayed fetal-to-adult hemoglobin switch in infants of diabetic mothers (butyrate 3 ) and in the elevated HbF levels seen in children with inherited disorders of branched-chain amino acid metabolism (eg, propionic acidemia 4 or ␤-ketothiolase deficiency 5 ). Importantly, therapeutic trials of butyrate in patients with ␤-globin gene disorders have increased ␥-globin gene expression and HbF levels. [6][7][8] Studies of the molecular and cellular effects of SCFAs in erythroid cells have been constrained by the limited number of experimental models currently available. We were interested in finding additional models in which to study the effects of SCFAs on erythropoiesis and on erythroid gene expression. We evaluated the effects of SCFAs on murine erythropoeisis in primitive and definitive erythroid precursor cells from transgenic mice that had endogenous elevations of SCFAs, and in definitive erythroid precursor cells from wt mice and human ␤-globin gene locuscontaining transgenic mice. These studies were undertaken with the expectation that a biologically relevant, primary, definitive erythroid precursor cell model would be an excellent place in which to study the pleiotropic effects of SCFAs on erythropoiesis.The murine ␤-globin gene locus, like the human, is developmentally regulated. ␤ H1 expression is detectable early and persists through embryonic day (E) 12 to 13, while ⑀ y expression is detected later and is present through E13 through 16. 9,10 These embryonic ␤-type globin genes, and the embryonic ␣-like -globin gene, are expressed in large, slowly enucleating, primitive erythroid (EryP) cells from the murine yolk sac. Adult ␤-type globin genes, ␤ Adult , comprise the ␤ maj and ␤ min genes (from the ␤-diffuse haplotype found in most strains) or the ␤ S and ␤ T genes (from the ␤-single haplotype found in the C57/black 6 strain). ␤ Adult and ␣ are expressed primarily in small, rapidly enucleated, definitive erythroid (EryD) cells that arise from the erythroid fetal liver through late gestation and from the adult bone marrow and, in anemic animals, from the adult e...

Iron control of erythroid development by a novel aconitase-associated regulatory pathway

“…32 Strikingly, DL-isocitrate reversed all of the phenotypic features of iron-restricted erythropoiesis, including abnormalities in the GPA/CD41 ratio, cellular structure, hemoglobinization, and globin expression ( Figure 3A-E). The 5-mM dose reproducibly restored erythroid GPA expression to 84% of the levels seen with 100% transferrin saturation ( Figure 3B).…”

Intermediaries of branched chain amino acid metabolism induce fetal hemoglobin, and repress SOX6 and BCL11A, in definitive erythroid cells

“…Butyrate, in the absence of exogenous erythropoietin (EPO), has been shown to preferentially induce Gγ expression in definitive erythroid cells [39,42]. Further, BCAAs are metabolized in the human placenta which supplies the human fetal liver, where Gγ expression predominates.…”

“…FL EryD derived from mice transgenic for the human β-globin gene locus, hu-β FL EryD [37], predominantly express the adult human β-type globin gene, hu-β and little of the fetal human β-type globin gamma, γ. Both transformed MEL cells and hu-β FL EryD will express embryonic or fetal β-type globin genes, respectively, when induced by butyrate [38,39]. Therefore, we tested the intermediaries of BCAA metabolism, in both MEL cells and in hu-β FL EryD, for their ability to induce fetal/embryonic globin gene expression.…”

“…Human globin primers and murine SOX6 and BCL11A primers were designed for detection with SYBR Green (ABI). All murine and human probes are as previously published [39]. Murine BCL11A and SOX6 primers were TTCGGATGGAAGCTCAAGAACCCT (S) and TAGCAGGATA ACGGAGCACGTTGA (AS); SOX6 AATCAGAGCCCAGGTTTGTCTCCA (S) and TGCCAACTAGGCTTCTCAT GTCCA (AS).…”

“…Histones were extracted from FL EryD and analyzed by Western blot with antibodies raised against acylated and non-acylated histone H3, as described previously [39].…”