Sex-Based Differences in Human Neutrophil Chemorepulsion

Abstract

A considerable amount is known about how eukaryotic cells move toward an attractant, and the mechanisms are conserved from Dictyostelium discoideum to human neutrophils. Relatively little is known about chemorepulsion, where cells move away from a repellent signal. We previously identified pathways mediating chemorepulsion in Dictyostelium, and here we show that these pathways, including Ras, Rac, protein kinase C, PTEN, and ERK1 and 2, are required for human neutrophil chemorepulsion, and, as with Dictyostelium chemorepulsion, PI3K and phospholipase C are not necessary, suggesting that eukaryotic chemorepulsion mechanisms are conserved. Surprisingly, there were differences between male and female neutrophils. Inhibition of Rho-associated kinases or Cdc42 caused male neutrophils to be more repelled by a chemorepellent and female neutrophils to be attracted to the chemorepellent. In the presence of a chemorepellent, compared with male neutrophils, female neutrophils showed a reduced percentage of repelled neutrophils, greater persistence of movement, more adhesion, less accumulation of PI(3,4,5)P3, and less polymerization of actin. Five proteins associated with chemorepulsion pathways are differentially abundant, with three of the five showing sex dimorphism in protein localization in unstimulated male and female neutrophils. Together, this indicates a fundamental difference in a motility mechanism in the innate immune system in men and women.

Differences between human male and female neutrophils in mRNA, translation efficiency, protein, and phosphoprotein profiles

“…It is unclear how phosphorylation of PRUNE2 affects its function. Together these data indicate that SLIGKV affects protein phosphorylation in male but not female neutrophils at 5 and 20 minutes, in agreement with the faster responses of male neutrophils to SLIGKV [43].…”

“…The PCR was performed using 40 cycles and started with 2.5 minutes hold at 95°C followed by 40 cycles of 5 seconds at 95°C, 20 seconds at 60°C, and 15 seconds at 95°C. Primer pairs were, listed 5' to 3', modi ed from previously published work for GAPDH [48], or purchased commercially for PDE6A (#HP200420; OriGene, Rockville, MD): GAPDH primers: GCACCGTCAAGGCTGAG CCACTTGATTTTGGAGGGATCTC PDE6A primers: GTCCGTGCTTTCCTCAACTGTG GGACCAGAGTAAGGTGGAACTTC Proteomics, phosphoproteomics, and gene ontology Proteomics was performed as described [43]. Brie y, in-gel protein preparation of tryptic peptides was performed at the University of Texas Southwestern Proteomics Core (https://proteomics.swmed.edu/wordpress/?page_id=553) for Thermo Fusion Lumos standard gradient mass spectrometry.…”

“…ARDS, aspiration of SLIGKV inhibits the number of neutrophils in the lungs [ 42 ]. Surprisingly, compared to human female neutrophils, male neutrophils showed a faster response to SLIGKV [ 42 , 43 ], and there were several differnces between male and female neutrophils in the signal transduction pathway mediateing chemorepulsion in response to SLIGKV [ 43 ].…”

Competition Between Chemoattractants Causes Unexpected Complexity and Can Explain Negative Chemotaxis

“…Negative chemotaxis is implicated in a wide range of wholeorganism processes, including development, 2 immunity, 3,4 disease, 5 and cancer metastasis. 6 For example, neurites in the developing brain avoid areas high in semaphorins, 7 and semaphorin knockout mice die at or before birth.…”

Competition between chemoattractants causes unexpected complexity and can explain negative chemotaxis

“…Negative chemotaxis is implicated in a wide range of whole-organism processes including development (Pasquale, 2000), immunity (Colom et al, 2015, Consalvo et al, 2022) pathogenesis (Zaki et al, 2006) and cancer metastasis (Jongsma et al, 2011). For example, neurites in the developing brain avoid areas high in semaphorins (Sakai and Halloran, 2006), and semaphorin knockout mice die at or before birth (Fiore et al, 2005).…”