Sesquiterpenoids from the Aerial Parts of Salvia plebeia with Inhibitory Activities on Proprotein Convertase Subtilisin/Kexin Type 9 Expression

Abstract

Phytochemical investigation of the methanol extract of the aerial parts of Salvia plebeia aided by a proprotein convertase subtilisin/kexin type 9 (PCSK9) mRNA expression screening assay in HepG2 cells led to the identification of 19 compounds including one new norsesquiterpene (1), six new eudesmane sesquiterpenoids (2−5, 8, and 11), and 12 known compounds. The structures of all compounds were elucidated by interpretation of their 1D and 2D NMR spectroscopic and MS data. Furthermore, computational prediction of ECD or chemical shifts was used to propose the absolute configurations of the new structures. All isolates were assessed for their inhibitory activities against PCSK9 mRNA expression and PCSK9−low-density lipoprotein receptor (LDLR) interactions. None of the isolated compounds inhibited PCSK9 and LDLR interactions. However, compounds 1, 9, and 10 downregulated PCSK9 mRNA expression.

Prenylated Flavonoid Glycosides with PCSK9 mRNA Expression Inhibitory Activity from the Aerial Parts of Epimedium koreanum

“…As part of our ongoing project to discover PCSK9 expression inhibitory compounds from medicinal plants [17][18][19][20], the n-BuOH-soluble fraction of the aerial parts of E. koreanum was selected for further investigation due to its initial PCSK9 mRNA expression inhibitory activity (Supplementary Material Figure S1-1). However, there are no reports regarding PCSK9 inhibitory substances from this plant.…”

Isocoumarins and Benzoquinones with Their Proprotein Convertase Subtilisin/Kexin Type 9 Expression Inhibitory Activities from Dried Roots of Lysimachia vulgaris

“…The known structure compounds (3)(4)(5)(6)(7)(8)(9)(10)(11)(12)(13)(14)(15)(16)(17)(18)(19)(20)(21)(22) were identified by comparison of their spectroscopic data with the reported values, as 5-O-methylembelin (3), 20 5-O-methylrapanone (4), 21 9-hydroxy-(9S,10E,12Z,15Z)-octadecatrienoic acid (5), 22 9-oxo-(10E,12E)-octadecadienoic acid (6), 23 9-oxo-(10E,12Z)-octadecadienoic acid (7), 23 2,3-dihydroxypropyl-(10Z,13Z)-nonadecadienoate (8), 24 2,3-dihydroxypropylpentadecadienoate ( 9), 25 1-monopalmitoyl-rac-glycerol (10), 26 monononadecanoin (11), 27 methyl linoleate ( 12), 6 linoleic acid (13), 6 oleic acid ( 14), 24 capric acid (15), 28 lauric acid (16), 29 palmitic acid (17), 30 stearic acid (18), 31 (+)-demethoxylpinoresinol (19), 6 (+)-pinoresinol (20), 6 trans-cinnamic acid (21), 32 and cis-ferulic acid (22). 33 The known compounds (3)…”

“…PCR analysis was performed according to the previously reported method. − The following specific primer sets were used (5′ to 3′): GAPDH: GAAGGTGAAGGTCGGAGTCA (forward), AATGAAGGGGTCATTGATGG (reverse); PCSK9GGGCATTTCACCATTCAAAC (forward), TCCAGAAAGCTAAGCCTCCA (reverse); IDOL­(MYLIP): ACGGTCACCAAGGAATCTGGGA (forward), CCTTCAAGTCACGGCTATACTGC (reverse); LXR-α­(NR1H3): TGGACACCTACATGCGTCGCAA (forward), CAAGGATGTGGCATGAGCCTGT (reverse); SREBP1: ACTTCTGGAGGCATCGCAAGCA (forward), AGGTTCCAGAGGAGGCTACAAG (reverse) and SREBP2: CTCCATTGACTCTGAGCCAGGA (forward), GAATCCGTGAGCGGTCTACCAT (reverse). Gene-specific primers were custom-synthesized by Bioneer (Daejeon, Korea).…”

“…Our ongoing project has been to discover small molecules from edible and medicinal plants with inhibitory activity against PCSK9 mRNA expression. − During this project, it was found that the hexane-soluble extract of L. vulgaris roots inhibited PCSK9 mRNA expression, increasing LDLR mRNA expression (Figure S1).…”

An improved ultra-high performance liquid chromatography-tandem mass spectrometry method determining hispidulin and homoplantaginin in rat plasma and associated pharmacokinetic studies

“…It is cooling in nature and pungent to taste, effectively clears away heat and toxins, cools the blood, and dissipates blood stasis, diuresis, and swelling [4][5][6][7]. Previous pharmacological studies have shown that S. plebeia has antiasthmatic, anti-bacterial, and anti-oxidant effects [8][9][10][11][12]. The plant mainly contains flavonoids, terpenes, phenolic acids, volatile oils, phytosterols, and other compounds [12,13].…”