Sensitive and specific detection of strains of Japanese encephalitis virus using a one‐step TaqMan RT‐PCR technique

Abstract

A rapid, sensitive, and accurate laboratory diagnostic test is needed for distinguishing Japanese encephalitis virus (JEV) from other diseases featuring similar clinical symptoms and also for preventing potential outbreaks. In this study, a TaqMan reverse transcription (RT)-polymerase chain reaction (PCR) assay was developed for rapid detection and quantification of the viral RNA of various JEV strains. A consensus JEV NS3 region was chosen to design the primers and the TaqMan probe. The JEV TaqMan assay used the EZ-rTtH RT-PCR system featuring advantages such as a one-step, high-temperature RT reaction modality and preventing carry-over contamination. The sensitivity of the JEV TaqMan assay for detecting in vitro-transcribed JEV NS3 RNA was estimated to be one to five copies of RNA per reaction. For cultured JE virions, less than 40 plaque forming unit (PFU)/ml of virus load (corresponding to 0.07 PFU/test) could be detected. In addition, the JEV TaqMan assay could detect all seven strains of JEV tested, but provided negative results for nine other flaviviruses and encephalitis viruses tested. The JEV TaqMan assay demonstrated greater sensitivity and specificity than traditional RT-PCR methods as has been previously reported. The application of the JEV TaqMan assay herein has been shown to the sensitive detection of the JEV from both mosquito pools and also JEV-spiking human blood. The assay should be of use in diagnostic laboratory conduct and could be used to replace or complement time-consuming viral-culture methods, thus achieving more rapid, sensitive, and highly specific identification of JEV infection.

Japanese Encephalitis Virus Disrupts Cell-Cell Junctions and Affects the Epithelial Permeability Barrier Functions

“…cDNA synthesis was performed using Omniscript Reverse Transcription System (Qiagen) using random hexamers as per manufacturer’s instructions. 100 ng of cDNA was used to determine JEV genome copy numbers using Taqman quantitative RT-PCR reagent (Life Technologies) using primers and probe described previously [20]. 200 ng of cDNA was used for detection of various genes using Fast SYBR Green quantitative RT-PCR reagent (Life Technologies) using primers as listed in Table S1.…”

Rapid Detection and Quantification of Japanese Encephalitis Virus by Real‐Time Reverse Transcription Loop‐Mediated Isothermal Amplification

“…To date, several studies have detected latent JEV in the body of mosquitoes using real-time PCR (19), and in the serum of humans, pigs, and mice (8,21,25). DENV has been reported to be detected by RT-LAMP in the serum of DENV-infected patients (16).…”

“…Recently, several investigators have reported polymerase chain reaction (PCR)-based detection systems for the rapid detection of JEV infection in clinical specimens that were negative for viral isolation, suggesting that nucleic acid-based assays hold greater promise for the detection of JEV infection. In addition to traditional reverse transcription-polymerase chain reaction (RT-PCR), more rapid and sensitive real-time PCR-based assays, such as TaqMan RT-PCR, nucleic acid sequence-based amplification (NASBA) and branched-DNA methods, have been reported and are currently under extensive evaluation with human and field mosquito samples (8,19,21,25) However, these assays usually take 2-3 hr.…”

Bispidine-Amino Acid Conjugates Act as a Novel Scaffold for the Design of Antivirals That Block Japanese Encephalitis Virus Replication

“…Standard curve was generated using in vitro transcribed JEV-NS3 from a plasmid clone. Viral genome copy numbers were estimated using NS3 primer and probe set described previously [9]. GAPDH was used for normalization of the samples (Forward primer: 5′- TGTGTCCGTCGTGGATCTGA - 3′ Reverse primer: 5′- CCTGCTTCACCACCTTCTTGA - 3′ Taqman probe: 5′-FAM-CCGCCTGGAGAAACCTGCCAAGTATG-TAMRA).…”