Secretion and Transcriptional Regulation of the Latex-Clearing Protein, Lcp, by the Rubber-Degrading Bacterium Streptomyces sp. Strain K30

Abstract

About 22,000 1-methyl-3-nitro-1-nitrosoguanidine-and UV-induced mutants of the rubber-degrading bacterium Streptomyces sp. strain K30 were characterized for the ability to produce clear zones on natural rubber latex overlay agar plates. Thirty-five mutants were defective solely in cleavage of rubber and were phenotypically complemented with the wild-type lcp (latex clearing protein) gene. Sixty-nine mutants exhibited a pleiotropic phenotype and were impaired in utilization of rubber and xylan, indicating that the enzymes responsible for the initial cleavage of these polymers are exported by the same secretion pathway (Q. In contrast, oxiB and oxiA, which are located directly downstream of lcp and putatively encode a heteromultimeric aldehyde dehydrogenase oxidizing the primary cleavage products generated by Lcp from poly(cis-1,4-isoprene), were expressed only in the presence of poly(cis-1,4-isoprene). Expression of lcp at a low level is thus required for sensing the polymer in the medium. Rubber degradation products may then induce the transcription of genes coding for enzymes catalyzing the later steps of poly(cis-1,4-isoprene) degradation and the transcription of lcp itself. lcp, oxiB, and oxiA seem to constitute an operon, as a polycistronic mRNA comprising these three genes was detected. The transcriptional start site of lcp was mapped 400 bp upstream of the lcp start codon.KThe microbial degradation of natural and synthetic poly(cis-1,4-isoprene) rubber is currently being intensively investigated (for a review, see reference 24), and two different strategies for degradation of isoprene rubber have been described (18). Members of one group of organisms form clear zones on natural rubber latex agar plates and generally belong to the mycelium-forming actinomycetes, such as Actinoplanes, Streptomyces, and Micromonospora. Members of the second group comprise nocardioform actinomycetes like Gordonia, Mycobacterium, and Nocardia and do not produce translucent halos; instead, they require direct contact with the rubber substrates (37). Xanthomonas sp. strain 35Y is the only known rubberdegrading bacterium that does not belong to the actinomycetes but is a gram-negative bacterium (34); however, in terms of its strategy for rubber degradation, it belongs to the first group and forms halos on rubber-containing agar plates.Whereas no proteins involved in rubber degradation in the nocardioform actinomycetes are known so far, the rubbercleaving dioxygenase RoxA occurring in culture supernatants of Xanthomonas sp. strain 35Y (16, 34) and the lcp gene encoding Lcp (latex clearing protein) in Streptomyces sp. strain K30 have recently been identified and characterized by Braaz et al. (6) and Rose and Steinbüchel (27), respectively. Both of these bacteria belong to the so-called clear-zone-forming group of rubber-degrading bacteria, and obviously, both RoxA and Lcp are secreted into the extracellular medium, leading to the formation of translucent halos on natural rubber latex. Sequence analysis of Lcp and characterization...

Involvement of Two Latex-Clearing Proteins during Rubber Degradation and Insights into the Subsequent Degradation Pathway Revealed by the Genome Sequence of Gordonia polyisoprenivorans Strain VH2

“…Furthermore, secretion of Lcp via the Tat pathway was already demonstrated in the clear-zone-forming Streptomyces sp. strain K30 (96). The amino acid sequences of Lcp are highly conserved.…”

“…strain K30, this step is thought to be catalyzed via a heterodimeric molybdenumdependent hydroxylase encoded by oxiAB, which is located downstream of lcp. It enables the strain to oxidize these aldehyde intermediates (73), and it is transcribed during rubber degradation but not during growth on glucose (96). G. polyisoprenivorans does not possess oxiA and oxiB homologues.…”

Latex Clearing Protein (Lcp) of Streptomyces sp. Strain K30 Is a b -Type Cytochrome and Differs from Rubber Oxygenase A (RoxA) in Its Biophysical Properties

“…The lcp K30 gene sequence was cloned into pUC9 via single NdeI and HindIII sites using pMK::lcp (Table 1) as the template. For substitution of the lcp TAT-dependent signal sequence (20) with the Strep-tag, the resulting vector pUC9::lcp was used as the template for PCR with the following primers: strep_f, GCTCATATGTG GAGCCACCCGCAGTTCGAAAAAGAGAACCTCTACTTCCAGGGC CTGCAGCGACCACTGTGGACGTGGTCACCGAGC; lcp-strep-r, GTCA ATAAACCGGTAAGCTTTCAGGACG. The resulting Strep-tag-lcp DNA sequence (ϳ1.25 kbp) was cut with NdeI and HindIII and subcloned into p4782.1 (Table 1), yielding p4782.1::strep-lcp.…”

RoxB Is a Novel Type of Rubber Oxygenase That Combines Properties of Rubber Oxygenase RoxA and Latex Clearing Protein (Lcp)

“…2-Oxo-4,8-dimethyltrideca-4,8-diene-1-al (ODTD) is the major rubber degradation product of all biochemically characterized RoxAs. Investigation of rubber degradation by Gram-positive species in A. Steinbüchel=s group led to the identification of a second type of rubber oxygenase (named latex clearing protein [Lcp]) (13)(14)(15)(16)(17)(18). Meanwhile the Lcps from species of four different genera (Streptomyces, Gordonia, Rhodococcus, and Nocardia) have been purified and biochemically characterized (19)(20)(21)(22)(23).…”