Right-To-Left Ventricular Differences in the Expression of Mitochondrial Hexokinase and Phosphorylation of Akt

Abstract

Background/Aims: Hexokinase (HK) is a key glycolytic enzyme which promotes the maintenance of glucose homeostasis in cardiomyocytes. HK1 isoform is predominantly bound to the outer mitochondrial membrane and highly supports oxidative phosphorylation by increasing the availability of ADP for complex V of the respiratory chain. HK2 isoform is under physiological conditions predominantly localized in the cytosol and upon stimulation of PI3K/ Akt pathway associates with mitochondria and thus can prevent apoptosis. The purpose of this study was to investigate expression and subcellular localization of both HK isoforms in left (LV) and right (RV) heart ventricles of adult male Wistar rats. Methods: Real-Time RT-PCR, Western blotting, and quantitative immunofluorescence microscopy were used. Results: Our results showed a significantly higher expression of both HK1 and HK2 at mRNA and protein levels in the RV compared to the LV. These findings were corroborated by immunofluorescence staining which revealed substantially higher fluorescence signals of both HKs in the RV than in the LV. The ratios of phospho-Ser473-Akt/non-phospho-Akt and phospho-Thr308-Akt/non-phospho-Akt were also markedly higher in the RV than in the LV. Conclusion: These results suggest that the RV has a higher activity of aerobic glycolytic metabolism and may be able to respond faster and more powerfully to stressful stimuli than the LV.

Chronic Hypoxia Enhances Expression and Activity of Mitochondrial Creatine Kinase and Hexokinase in the Rat Ventricular Myocardium

“…Protein and mRNA levels of both HK isoforms were markedly higher in the normoxic RV than in the LV, which is in line with our previous findings [43]. All hypoxic regimens similarly increased HK1 protein levels in the LV (by 99 %, 95 %, and 86 % in CNH, INH-23, and INH-8 groups, respectively), but did not affect HK1 mRNA levels.…”

“…The fluorescence analysis showed a higher co-localization of HK1 with mitochondria than HK2 in the normoxic LV and RV, which is in accordance with our previous study [43]. In addition, a higher co-localization of HK1 with mitochondria, compared to HK2, was also observed in the RV of CNH rats.…”

“…All procedures including isolation of total mRNA, following reverse transcription as well as PCR quantification were described previously in details [43]. Real-Time RT-PCR analyses were performed according to manufacture instructions by Light Cycler Roche using Light Cycler 480 Probes Master and the following specific primers together with Mono-Color Hydrolysis Probes (# ) designed by the Universal Probe Library Assay Design Center (UPL, Roche Applied Science): HK1_F: tctgggcttcaccttctcat, HK1_R: atcaagattccacagtccaggt and #121; HK2_F: ccagcagaacagcctagacc, HK2_R: agatgccttgaatccctttg and #101; CKM_F: ccgcagcatcaagggtta, CKM_R: cccgtcaggctgttgaga and #16; CKB_F: ccacttcctcttcgacaagc, CKB_R: ggaacgtcttattgtcattgtgc and #84; mtCKs_F: gccaccccttcattaagactg, mtCKs_R: caaaaaggtcagcaaacacct and #83; HPRT_F: gaccggttctgtcatgtcg, HPRT_R: acctggttcatcatcactaatcac and #95.…”

“…All steps of protein expression analysis were performed essentially as described previously [43]. Samples from each experimental group and from both ventricles were always run on the same gel and quantified on the same membrane.…”

“…Appropriate sampling density, precise background subtraction, and correctly processed deconvolution along with Replicate-Based Noise Corrected Correlation (RBNCC) method enabled us to reliably assess signal co-localization. All detailed steps of immunofluorescence staining, fluorescence microscopy, and quantification were performed as described previously [43]. …”