RETRACTED: Osthole attenuates APP-induced Alzheimer's disease through up-regulating miRNA-101a-3p

Lin, Ying; Liang, Xicai; Yao, Yingjia; Xiao, Honghe; Shi, Yue; Yang, Jingxian

doi:10.1016/j.lfs.2019.04.004

Cited by 45 publications

(31 citation statements)

References 43 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…For example, the activation of miR-3557/324 could regulate the CaMKs signalling pathway to decrease the incidence of PD [11]. The decline of miR-101a level accelerated the progress of AD [12]. Moreover, a study showed that the decline of miR-199a-5p, as well as miR-199a-3p levels, was involved in PD [13].…”

Section: Introductionmentioning

confidence: 99%

Dexmedetomidine protects PC12 cells from oxidative damage through regulation of miR-199a/HIF-1α

Yang

Kong

2020

Artificial Cells, Nanomedicine, and Biotechnology

View full text Add to dashboard Cite

Background: Although dexmedetomidine (Dex) has a significant neuroprotective effect in various nerve-damage models, the exact mechanism of which Dex protects cells from oxidative damage is not fully clear. This article recommended the protective effect of Dex on oxidative damage in PC12 cells. Methods: The PC12 cells were incubated by hydrogen peroxide (H 2 O 2) for 24 h and pre-treated by Dex for 30 min. Cell viability, apoptosis, HIF-1a expression and ROS level were detected by CCK-8, apoptosis assay, Western blot and ROS assay, respectively. The miR-199a expression was tested by qRT-PCR. Targeting relationship between miR-199a and HIF-1a was performed by dual luciferase activity assay. The activation of PI3K/AKT/mTOR and Wnt/b-catenin pathways was tested by western blot. Results: Dex attenuated H 2 O 2-induced oxidative damage, including the decline of cell viability, the raise of apoptosis and the generation of ROS in PC12 cells by down-regulating miR-199a expression. Moreover, Dex up-regulated HIF-1a expression via decreasing miR-199a level in PC12 cells and miR-199a targeted the 3 0-UTR of HIF-1a. In addition, Dex activated PI3K/AKT/mTOR and Wnt/b-catenin pathways by declining miR-199a level. Conclusions: This article illustrated the protective effect of Dex on oxidative damage in PC12 cells. Furthermore, Dex prevented PC12 cells from oxidative injury through the regulation of miR-199a/ HIF-1a.

show abstract

Section: Introductionmentioning

confidence: 99%

Dexmedetomidine protects PC12 cells from oxidative damage through regulation of miR-199a/HIF-1α

Yang

Kong

2020

Artificial Cells, Nanomedicine, and Biotechnology

View full text Add to dashboard Cite

show abstract

“…Total RNA was extracted with TRIzol reagent (Life Technologies) following the manufacturer's instructions, and extracted RNA was quantified. IL-6 and TNF-α expression was examined via standard RT-PCR and normalized to β-actin expression as an endogenous control [12]. The primer sequences were as follows: IL-6: F: GTCCAGTTGCCTTCTCCC; R: GCCTCTTTGCTGCTTTCA; TNF-α F: GATTCAGGGATGTGTGGCCT R: GCCACATTCCAGATGTCCCA; :β-actin: F: CCCGAGCCGTGTTTCCT; R:…”

Section: Rt-pcr Analysismentioning

confidence: 99%

“…Cells were lysed in radioimmunoprecipitation assay buffer with Protease Inhibitor Cocktail (Sigma), separated in sodium dodecyl sulfate polyacrylamide gels, and transferred to a polyvinylidene fluoride membrane. The membrane was incubated with anti-IL6, anti-TNF-α and anti-β-actin (Abcam, Cambridge, MA, USA) at 4°C overnight, followed by incubation with horseradish peroxidaseconjugated secondary antibody for 1 h. Bands were visualized with ECL [12].…”

Section: Western Blot Analysismentioning

confidence: 99%

The correlation between vitamin D and maternal/infant outcomes, inflammatory response in pregnant women

Wei¹,

Jiang²,

Qiu³

et al. 2020

Preprint

View full text Add to dashboard Cite

Purposes To analyze the effects of vitamin D deficiency in pregnant women on common adverse pregnancy outcomes and small for gestational age (SGA) and to detect the expression of inflammatory factors in pregnant women to provide a theoretical basis for the treatment of vitamin D deficiency in pregnant women. Methods Serum samples from pregnant women from January 2015 to December 2015 were collected to measure the 25-(OH)D level. The effects of maternal age, pregnancy, season, parity and temperature on vitamin D levels in pregnant women were recorded. Then, the relationship between vitamin D levels and gestational diabetes mellitus, gestational hypertension, premature rupture of membranes, cesarean section, premature delivery and spontaneous abortion, and neonatal gestational age were analyzed. The expression of IL-6 and TNF-α in serum was detected by RT-PCR and western blot. Results The incidence of vitamin D deficiency, insufficiency and sufficiency in pregnant women in this region was 83.28%, 15.36% and 1.36%, respectively. Age, pregnancy, sampling season and parity were the influencing factors on vitamin D level, and multivariate logistic regression analysis showed that summer, autumn and temperature were protective factors for adequate vitamin D in pregnant women (P <0.05). Vitamin D levels in pregnant women were associated with preterm birth, spontaneous abortion and SGA. The incidences of preterm birth, spontaneous abortion and SGA were higher in the vitamin D deficiency group (P<0.05). ConclusionThe serum vitamin D level of pregnant women in this area is low and is affected by multiple factors such as age, pregnancy, season, parity and temperature. Low vitamin D levels can increase the risk of premature birth, spontaneous abortion and SGA in pregnant women, and its low expression is common. As it also leads to inflammation, increasing the level of vitamin D in the serum of pregnant women can effectively reduce the occurrence of related diseases.

show abstract

“…The target genes of miRNA-146a-5p were predicted by Targetscan [10] (http://www.targetscan.org/vert_72/), miRDB [11] (http://mirdb.org/), miRWalk [12] (http://zmf.umm.uniheidelberg.de/apps/zmf/mirwalk/), and PicTar [13] (https://pictar.mdc-berlin.de/), the results were admitted into draw Venn diagram [14] and the results belonged to the 4 databases were selected. Then we get the sequence of miRNA-146a-5p and the target gene and look for the combining site to identify the relationship between them.…”

Section: Bioinformatics Analysismentioning

confidence: 99%

The expression of miRNA-146a-5p and its mechanism of treating dry eye syndrome

Yin

Zhang

et al. 2020

Preprint

View full text Add to dashboard Cite

Background: Dry eye syndrome in which tear fluid quality or abnormality or kinetic abnormality is caused by many causes, resulting in decreased tear film stability. In recent years, more and more results from the studies indicate that miRNA alterations are involved in dry eye syndrome. And miRNA-146a-5p is a key regulator to regulate the inflammatory response. In this paper, we demonstrated whether miRNA-146a-5p could cure dry eye syndrome by regulating target genes based on network analysis.Methods: In this paper, we collected the blood of patients with dry eye disease which served as a model group, the blood of healthy people was used as a control group. The expression of miRNA-146a-5p in the patients was detected by RT-PCR, the genes controlled by miRNA-146a-5p were predicted by Targetscan, miRDB, miRWalk and PicTar databases, the genes regulated by miRNA-146a-5p which is related to dry eye disease were selected by draw Venn diagram;Results: The comparison of the general information between patients and healthy people was no significant difference, and it indicated that the two groups were comparable. The results of databases showed that IRAK1 was one of the target genes regulated by miRNA-146a-5p and it is related to dry eye disease. The expression of miRNA-146a-5p was negatively related to IRAK1 mRNA and protein. While IRAK1 had positive correlation with IL-6, TNF-α and CBP proteins. Conclusion: These results emphasized that miRNA-146a-5p could inhibit the expression of IRAK1, IL-6, TNF-α and CBP so as to help reduce the inflammatory response in dry eye syndrome.

show abstract

RETRACTED: Osthole attenuates APP-induced Alzheimer's disease through up-regulating miRNA-101a-3p

Cited by 45 publications

References 43 publications

Dexmedetomidine protects PC12 cells from oxidative damage through regulation of miR-199a/HIF-1α

Dexmedetomidine protects PC12 cells from oxidative damage through regulation of miR-199a/HIF-1α

The correlation between vitamin D and maternal/infant outcomes, inflammatory response in pregnant women

The expression of miRNA-146a-5p and its mechanism of treating dry eye syndrome

Contact Info

Product

Resources

About