Rapid sexing of murine preimplantation embryos using a nested, multiplex polymerase chain reaction (PCR)

Fluorescent in situ hybridization for sex chromosome determination before and after fertilization in mice

“…The ability to visualize both X and Y chromosomes simultaneously at each stage provides accurate gender annotation and thus greatly reduces the potential for misdiagnosis of genotypic sex. Many previous studies that have employed either PCR or FISH for gender identification have focused on a particular stage of pre-implantation development [19,21,35] or a specific tissue type, e.g. yolk sac tissue [36].…”

“…; males: 5.0 ± 1.0; females 6.0 ± 1.0; P > 0.05). The previously published microwave decondensation technique used for sperm [35] resulted in a loss of conceptuses from slides and could not be used to assess the presence of sex chromosomes.…”

Variable Reprogramming of the Pluripotent Stem Cell Marker Oct4 in Mouse Clones: Distinct Developmental Potentials in Different Culture Environments

“…When analysis of Xist (GenBank AJ421479) was required, the RLT lysate was split into two aliquots: 37.5 μl was used for RT and PCR of Xist RNA (with DNase treatment performed on column) with primers 5′‐CATAGCCCCTTCCCAATAGGTC‐3′ and 5′‐CTACTTGGGCGTTCACTTCAGAG‐3′ (143‐bp amplicon); 37.5 μl was used for sexing with Y chromosome ( Zfy locus)‐specific primers and X chromosome ( DXNds3 locus)‐specific primers [33].…”

Molecular Mechanisms of Cell Differentiation in Gonad Development

“…First, Y-linked sequences, such as Sry Greenlee et al 1998;Kunieda et al 1992;Lambert et al 2000;Lavrovsky et al 1998;McClive and Sinclair 2001) or Zfy (Greenlee et al 1998;Kunieda et al 1992;Nagamine et al 1990;, can be amplified and detected indicating the male genetic sex. Nowadays, the most extensively used method to define the sex of an individual is genotyping relying on sex-specific gene identification by PCR (polymerase chain reaction).…”

“…Nowadays, the most extensively used method to define the sex of an individual is genotyping relying on sex-specific gene identification by PCR (polymerase chain reaction). The X-linked gene Dxnds3 is an example of such an internal control in multiplex PCR (Greenlee et al 1998;Kunieda et al 1992). A series of genes are used as sex markers.…”