Rapid regulation of protein activity in fission yeast

Bøe, Cathrine Arnason; García, Ignacio; Pai, Chen-Chun; Sharom, Jeffrey R.; Skjølberg, Henriette C.; Boye, Erik; Kearsey, Stephen; MacNeill, Stuart A.; Tyers, Michael; Grallert, Beáta

doi:10.1186/1471-2121-9-23

Cited by 12 publications

(9 citation statements)

References 40 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Inactivation of GINS function is readily reversible, because on readdition of ␤-estradiol DNA replication is activated within 1h ( Figure 1B), and viability of the released cells is high (data not shown). Similar results were obtained with a strain where Psf2 is tagged with HBD (Bøe et al, 2008).…”

Section: Conditional Inactivation Of Psf1 and Psf2supporting

confidence: 84%

“…Plasmid pFA6a-HBD-kanMX6 was used as template (Bøe et al, 2008) with the following PCR primers: 5Јaccttactaaaaattcacaattgcatgt-gcgtgctacagacgttgaacgactcattgcccaaggttttttggctaagttacggatcccgggttaattaa-3Ј and 5Ј-atggtaggaatgaatggcttatggatgaaatttttagggtcagttcaaaaagcagtgaaactcttatttgggaaacagaggaattcgagctcgtttaaac-3Ј. Psf1 was tagged with YFP by amplifying a C-terminal region of the psf1 ϩ gene with the primers: 5Ј ApaI-Psf1, 5Ј-TTTgggcccGTTTGGGGAATCGATCAAATAAATTAATTC-3Ј and 3Ј XhoI-Psf1, 5Ј-TTTctcgagTAACTTAGCCAAAAAACCTTGGGCAATGAG-3Ј.…”

Section: Tagging Fission Yeast Proteinsmentioning

confidence: 99%

See 1 more Smart Citation

GINS Inactivation Phenotypes Reveal Two Pathways for Chromatin Association of Replicative α and ε DNA Polymerases in Fission Yeast

Pai

García

Wang

et al. 2009

MBoC

View full text Add to dashboard Cite

The tetrameric GINS complex, consisting of Sld5-Psf1-Psf2-Psf3, plays an essential role in the initiation and elongation steps of eukaryotic DNA replication, although its biochemical function is unclear. Here we investigate the function of GINS in fission yeast, using fusion of Psf1 and Psf2 subunits to a steroid hormone-binding domain (HBD) to make GINS function conditional on the presence of ␤-estradiol. We show that inactivation of Psf1-HBD causes a tight but rapidly reversible DNA replication arrest phenotype. Inactivation of Psf2-HBD similarly blocks premeiotic DNA replication and leads to loss of nuclear localization of another GINS subunit, Psf3. Inactivation of GINS has distinct effects on the replication origin association and chromatin binding of two of the replicative DNA polymerases. Inactivation of Psf1 leads to loss of chromatin binding of DNA polymerase , and Cdc45 is similarly affected. In contrast, chromatin association of the catalytic subunit of DNA polymerase ␣ is not affected by defective GINS function. We suggest that GINS functions in a pathway that involves Cdc45 and is necessary for DNA polymerase chromatin binding, but that a separate pathway sets up the chromatin association of DNA polymerase ␣.

show abstract

Section: Conditional Inactivation Of Psf1 and Psf2supporting

confidence: 84%

Section: Tagging Fission Yeast Proteinsmentioning

confidence: 99%

GINS Inactivation Phenotypes Reveal Two Pathways for Chromatin Association of Replicative α and ε DNA Polymerases in Fission Yeast

Pai

García

Wang

et al. 2009

MBoC

View full text Add to dashboard Cite

show abstract

“…It is known that the presence of affinity tags may affect important characteristics or functions of the protein of interest [62] and may interfere with protein activity [63]. Alterations in protein properties, structure and specific activity have been reported for fusion proteins relative to the native form [64][65][66]. In our case, both oxidoreductase activity and STAT-3 phosphorylase induction were impaired, suggesting that unfavorable interactions during folding of the fusion protein were responsible for this misfolding, as described previously [66].…”

Section: Discussionsupporting

confidence: 77%

“…Alternatively, the introduction of a recognition sequence for a chemical agent or a protease between the fusion partner and the target protein would allow for site-specific cleavage of the fusion protein to remove the affinity fusion partner [68,69]. Generally, the fusion protein would be refolded properly and would recover its bioactivity when the tag was cleaved off [64]. However, this always introduces additional challenges into the downstream processing.…”

Section: Discussionmentioning

confidence: 99%

Functional Improvement of Human Cardiotrophin 1 Produced in Tobacco Chloroplasts by Co-Expression with Plastid Thioredoxin m

Ancín¹,

Sanz-Barrio²,

Santamaría

et al. 2020

Plants

View full text Add to dashboard Cite

Human cardiotrophin 1 (CT1), a cytokine with excellent therapeutic potential, was previously expressed in tobacco chloroplasts. However, the growth conditions required to reach the highest expression levels resulted in an impairment of its bioactivity. In the present study, we have examined new strategies to modulate the expression of this recombinant protein in chloroplasts so as to enhance its production and bioactivity. In particular, we assessed the effect of both the fusion and co-expression of Trx m with CT1 on the production of a functional CT1 by using plastid transformation. Our data revealed that the Trx m fusion strategy was useful to increase the expression levels of CT1 inside the chloroplasts, although CT1 bioactivity was significantly impaired, and this was likely due to steric hindrance between both proteins. By contrast, the expression of functional CT1 was increased when co-expressed with Trx m, because we demonstrated that recombinant CT1 was functionally active during an in vitro signaling assay. While Trx m/CT1 co-expression did not increase the amount of CT1 in young leaves, our results revealed an increase in CT1 protein stability as the leaves aged in this genotype, which also improved the recombinant protein’s overall production. This strategy might be useful to produce other functional biopharmaceuticals in chloroplasts.

show abstract

“…Therefore, a sep1 culture consists of a mixture of single cells, doublets and mycelia of three or four cells. To start our experiments with a homogeneous population of cells we generated a conditional sep1 mutant by fusing the sep1 gene to the hormone-binding domain of the oestrogen receptor [ 32 ], enabling us to regulate the activity of the Sep1 protein by growing the cells in the presence (Sep1 on) or absence (Sep1 off) of oestradiol. To be able to synchronize the cells in G1 phase we introduced a temperature-sensitive cdc10 mutation.…”

Section: Resultsmentioning

confidence: 99%

Cosegregation of asymmetric features during cell division

et al. 2021

Self Cite

View full text Add to dashboard Cite

Cellular asymmetry plays a major role in the ageing and evolution of multicellular organisms. However, it remains unknown how the cell distinguishes ‘old’ from ‘new’ and whether asymmetry is an attribute of highly specialized cells or a feature inherent in all cells. Here, we investigate the segregation of three asymmetric features: old and new DNA, the spindle pole body (SPB, the centrosome analogue) and the old and new cell ends, using a simple unicellular eukaryote, Schizosaccharomyces pombe . To our knowledge, this is the first study exploring three asymmetric features in the same cells. We show that of the three chromosomes of S. pombe , chromosome I containing the new parental strand, preferentially segregated to the cells inheriting the old cell end. Furthermore, the new SPB also preferentially segregated to the cells inheriting the old end. Our results suggest that the ability to distinguish ‘old’ from ‘new’ and to segregate DNA asymmetrically are inherent features even in simple unicellular eukaryotes.

show abstract

Rapid regulation of protein activity in fission yeast

Cited by 12 publications

References 40 publications

GINS Inactivation Phenotypes Reveal Two Pathways for Chromatin Association of Replicative α and ε DNA Polymerases in Fission Yeast

GINS Inactivation Phenotypes Reveal Two Pathways for Chromatin Association of Replicative α and ε DNA Polymerases in Fission Yeast

Functional Improvement of Human Cardiotrophin 1 Produced in Tobacco Chloroplasts by Co-Expression with Plastid Thioredoxin m

Cosegregation of asymmetric features during cell division

Contact Info

Product

Resources

About