2015
DOI: 10.1590/s1517-838246320131291
View full text |Buy / Rent full text
|
Sign up to set email alerts
|

Abstract: Quinolones and fluoroquinolones are widely used to treat uropathogenic Escherichia coli infections. Bacterial resistance to these antimicrobials primarily involves mutations in gyrA and parC genes. To date, no studies have examined the potential relationship between biochemical characteristics and quinolone resistance in uropathogenic E. coli strains. The present work analyzed the quinolone sensitivity and biochemical activities of fifty-eight lactose-negative uropathogenic E. coli strains. A high percentage o… Show more

Help me understand this report

Search citation statements

Order By: Relevance

Paper Sections

Select...
1
1
1
1

Citation Types

0
4
0

Year Published

2018
2018
2022
2022

Publication Types

Select...
3

Relationship

0
3

Authors

Journals

citations
Cited by 5 publications
(29 citation statements)
references
References 32 publications
(29 reference statements)
0
4
0
Order By: Relevance
“…Apart from tetrathionate respiration, the metabolic profile of EcoFA807‐17 differs from commensal strains of E. coli in several ways. It does not decarboxylate lysine or ornithine which are known virulence factors among Escherichia/Shigella genomospecies (Casalino et al, 2003; Gomig et al, 2015; Maurelli et al, 1998), although it demonstrates Indole production, a trait long known to be typical of E. coli but much less common with Shigella (Rezwan et al, 2004) and certain other members of Enterobacteriaceae. Its sugar utilization resembles Shigella in being unable to metabolize lactose, sucrose, and xylose (Taylor, 1965).…”
Section: Resultsmentioning
confidence: 99%
See 1 more Smart Citation
“…Apart from tetrathionate respiration, the metabolic profile of EcoFA807‐17 differs from commensal strains of E. coli in several ways. It does not decarboxylate lysine or ornithine which are known virulence factors among Escherichia/Shigella genomospecies (Casalino et al, 2003; Gomig et al, 2015; Maurelli et al, 1998), although it demonstrates Indole production, a trait long known to be typical of E. coli but much less common with Shigella (Rezwan et al, 2004) and certain other members of Enterobacteriaceae. Its sugar utilization resembles Shigella in being unable to metabolize lactose, sucrose, and xylose (Taylor, 1965).…”
Section: Resultsmentioning
confidence: 99%
“…T A B L E 3 Biochemical phenotype of EcoFA807-17 compared with E. coli (ATCC 10536) et al, 2003;Gomig et al, 2015;Maurelli et al, 1998), although it demonstrates Indole production, a trait long known to be typical of E. coli but much less common with Shigella (Rezwan et al, 2004) and certain other members of Enterobacteriaceae. Its sugar utilization resembles Shigella in being unable to metabolize lactose, sucrose, and xylose (Taylor, 1965).…”
Section: Biochemical Phenotype and Antibiotic Resistance Profiles Of ...mentioning
confidence: 99%
“…Among the isolates harboring class 2 integron, only one contained a gene cassette comprising estX + sat2 + sat1. Previous studies have reported that the presence of gene cassettes associated with antimicrobial resistance indicates increased resistance rates (58,59) as well as increased potential for horizontal transfer (60).…”
Section: Discussionmentioning
confidence: 99%
“…The primers used for the amplification of parC gene are: ParC F: GTATGCGATGTCTGAACT and ParC: R TTCGGTGTAACGCATTGC for parC; whereas those used for the amplification of gyrA are: GyrA F: AAATCTGCCCGTGTCGTTGGT and GyrA R GCCATACCTACGGCGATACC. The amplification program involved initial denaturation at 95°C for 2 min followed by 35 cycle of 95°C 30 sec, 55.4°C 60 sec and 72°C 60 sec [21]. The PCR products were sent to Macrogen/ Korea for sequencing using Sanger method and after that were aligned with gene sequences from National Center for Biotechnological information (NCBI) (https://www.ncbi.nlm.nih.gov/) in order to inspect for mutations.…”
Section: Mussa and Al-mathkhurymentioning
confidence: 99%