Quercetin shows anti‐tumor effect in hepatocellular carcinoma LM3 cells by abrogating JAK2/STAT3 signaling pathway

Wu, Liwei; Li, Jingjing; Liu, Tong; Li, Sainan; Jiao, Feng; Yu, Qiang; Zhang, Jie; Chen, Jiaojiao; Zhou, Yuting; Ji, Jie; Chen, Kan; Mao, Yuqing; Wang, Fan; Dai, Weiqi; Fan, Xiaoming; Wu, Jianye; Guo, Chuanyong

doi:10.1002/cam4.2388

Cited by 120 publications

(88 citation statements)

References 71 publications

(145 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…We also have published some reports on the effects of PPARs in liver diseases. The protective effects of many Chinese herbal medicines, such as quercetin, oleanolic acid, proanthocyanidin B2, epigallocatechin‐3‐gallate, isorhamnetin and genistein, in liver diseases have been confirmed by our studies.…”

Section: Pparγ Agonists From Natural Productssupporting

confidence: 76%

Therapeutic potential of PPARγ natural agonists in liver diseases

Guo

2020

J Cellular Molecular Medi

Self Cite

View full text Add to dashboard Cite

Peroxisome proliferator‐activated receptor gamma (PPARγ) is a vital subtype of the PPAR family. The biological functions are complex and diverse. PPARγ plays a significant role in protecting the liver from inflammation, oxidation, fibrosis, fatty liver and tumours. Natural products are a promising pool for drug discovery, and enormous research effort has been invested in exploring the PPARγ‐activating potential of natural products. In this manuscript, we will review the research progress of PPARγ agonists from natural products in recent years and probe into the application potential and prospects of PPARγ natural agonists in the therapy of various liver diseases, including inflammation, hepatic fibrosis, non‐alcoholic fatty liver and liver cancer.

show abstract

Section: Pparγ Agonists From Natural Productssupporting

confidence: 76%

Therapeutic potential of PPARγ natural agonists in liver diseases

Guo

2020

J Cellular Molecular Medi

Self Cite

View full text Add to dashboard Cite

show abstract

“…Whitney U test. The GFAP primers were AGGTCC ATGTGGAGCTTGAC (forward) and GCCATTGCCT CATACTGCGT (reverse) and ACTNB primers were CTGGAACGGTGAAGGTGACA (forward) and AAGG GACTTCCTGTAACAATGCA (reverse) [62].…”

Section: Statistical Analysis Was Done Using One-tailed Mannmentioning

confidence: 99%

Single-nucleus RNA-seq identifies Huntington disease astrocyte states

Al‐Dalahmah

Sosunov

Shaik

et al. 2020

acta neuropathol commun

176

109

View full text Add to dashboard Cite

Huntington Disease (HD) is an inherited movement disorder caused by expanded CAG repeats in the Huntingtin gene. We have used single nucleus RNASeq (snRNASeq) to uncover cellular phenotypes that change in the disease, investigating single cell gene expression in cingulate cortex of patients with HD and comparing the gene expression to that of patients with no neurological disease. In this study, we focused on astrocytes, although we found significant gene expression differences in neurons, oligodendrocytes, and microglia as well. In particular, the gene expression profiles of astrocytes in HD showed multiple signatures, varying in phenotype from cells that had markedly upregulated metallothionein and heat shock genes, but had not completely lost the expression of genes associated with normal protoplasmic astrocytes, to astrocytes that had substantially upregulated glial fibrillary acidic protein (GFAP) and had lost expression of many normal protoplasmic astrocyte genes as well as metallothionein genes. When compared to astrocytes in control samples, astrocyte signatures in HD also showed downregulated expression of a number of genes, including several associated with protoplasmic astrocyte function and lipid synthesis. Thus, HD astrocytes appeared in variable transcriptional phenotypes, and could be divided into several different "states", defined by patterns of gene expression. Ultimately, this study begins to fill the knowledge gap of single cell gene expression in HD and provide a more detailed understanding of the variation in changes in gene expression during astrocyte "reactions" to the disease.

show abstract

“…Quercetin antitumor effects have been described in different cancer types, including HCC [1]. In 25 of the articles included in the present review, quercetin efficacy as single treatment was evaluated employing different HCC study models [22][23][24][25][26][27][28][29][30][31][32][33][34][35][36][37][38]46,48,49,[51][52][53][54]57]. Antiproliferative effect of this flavonoid alone has been demonstrated in several researches with in vitro models [22][23][24][25][26][27][30][31][32][33]35,38,46,48,49,[51][52][53][54], highlighting the HepG2 cell line as the most used in 21 of the 25 articles [24,25,<...>…”

Section: Antitumor Properties Of Quercetin As Single Agent Against Hccmentioning

confidence: 99%

“…This ability to reverse glycolytic metabolism of liver cancer cells is often related to the efficacy of antitumor drugs such as quercetin [61]. Furthermore, it has been described that quercetin-derived inhibition of liver cancer cell growth could be mediated by the disruption of different pathways, including protein kinase B (Akt)/mammalian target of rapamycin (mTOR) [23,24], mitogen-activated protein kinase kinase 1 (MEK1)/extracellular signal-regulated kinase 1/2 (ERK1/2) [27,38] and Janus kinase 2 (JAK2)/signal transducer and activator of transcription 3 (STAT3) signaling routes [22]. Induction of p53 as consequence of phosphatidyl inositol 3 kinase (PI3K) and protein kinase C (PKC) downregulation was also linked to antiproliferative effects in liver tumor cells [31], in addition to the blockade of Src homology domain 2 containing tyrosine phosphatase-1/2 (SHP-1/2) activity through directly interacting with quercetin [48].…”

Section: Antitumor Properties Of Quercetin As Single Agent Against Hccmentioning

confidence: 99%

Antitumor Effects of Quercetin in Hepatocarcinoma In Vitro and In Vivo Models: A Systematic Review

et al. 2019

View full text Add to dashboard Cite

Quercetin is a flavonoid present in fruits, vegetables and plants with antioxidant, anti-inflammatory and anticancer properties. Its beneficial activities have been demonstrated in different human pathologies, including hepatoprotective effects against liver disorders. High mortality and late diagnosis of the primary liver tumor hepatocarcinoma (HCC) makes this cancer an interesting target for the study of quercetin effects. Our aim was to systematically review antitumor activities of quercetin in HCC preclinical studies employing single, encapsulated, combined or derived quercetin forms. Literature search was conducted in PubMed, Scopus and Web of Science (WOS), and 39 studies were finally included. We found that 17 articles evaluated quercetin effects alone, six used encapsulated strategy, 10 combined this flavonoid, two decided to co-encapsulate it and only four studied effects of quercetin derivatives, highlighting that only nine included in vivo models. Results evidence the quercetin antiproliferative and proapoptotic properties against HCC either alone and with the mentioned strategies; nevertheless, few investigations assessed specific activities on different processes related with cancer progression. Overall, further studies including animal models are needed to deeper investigate the precise mechanisms of action of quercetin as antitumor agent, as well as the potential of novel strategies aimed to improve quercetin effects in HCC.

show abstract

Quercetin shows anti‐tumor effect in hepatocellular carcinoma LM3 cells by abrogating JAK2/STAT3 signaling pathway

Cited by 120 publications

References 71 publications

Therapeutic potential of PPARγ natural agonists in liver diseases

Therapeutic potential of PPARγ natural agonists in liver diseases

Single-nucleus RNA-seq identifies Huntington disease astrocyte states

Antitumor Effects of Quercetin in Hepatocarcinoma In Vitro and In Vivo Models: A Systematic Review

Contact Info

Product

Resources

About