2015
DOI: 10.1111/jzs.12103
|View full text |Cite
|
Sign up to set email alerts
|

Phylogenetic systematics of leaffishes (Teleostei: Polycentridae, Nandidae)

Abstract: The Asian (nandid) and Afro-Neotropical (polycentrid) leaffishes represent two superficially similar, but historically poorly diagnosed families -a situation resulting in a convoluted systematic history. Here, and including for the first time in a molecular study all leaffish genera, we generate a hypothesis of the phylogenetic history of both groups. We analyse a multilocus molecular data set encompassing 257 acanthomorph taxa, carry out a survey and assessment of selected osteological characters for the poly… Show more

Help me understand this report

Search citation statements

Order By: Relevance

Paper Sections

Select...
1
1
1
1

Citation Types

2
26
2
1

Year Published

2017
2017
2022
2022

Publication Types

Select...
8

Relationship

2
6

Authors

Journals

citations
Cited by 23 publications
(31 citation statements)
references
References 57 publications
2
26
2
1
Order By: Relevance
“…The sister-group relationship of these two clades concurs with the definition of Anabantiformes proposed by Wiley and Johnson [37], although this order also includes Nandoidei (Asian leaffishes) in Betancur-R et al's scheme [19]. This topology is consistent with most of the hypotheses in the aspect of labyrinth fish phylogeny resolved based on morphological or molecular data [5,6,17,19,20,26]. However, it differs from Murray et al's morphology-based hypothesis, which did not support the monophyly of Anabantoidei [22].…”
Section: Phylogenetic Analysessupporting
confidence: 86%
See 1 more Smart Citation
“…The sister-group relationship of these two clades concurs with the definition of Anabantiformes proposed by Wiley and Johnson [37], although this order also includes Nandoidei (Asian leaffishes) in Betancur-R et al's scheme [19]. This topology is consistent with most of the hypotheses in the aspect of labyrinth fish phylogeny resolved based on morphological or molecular data [5,6,17,19,20,26]. However, it differs from Murray et al's morphology-based hypothesis, which did not support the monophyly of Anabantoidei [22].…”
Section: Phylogenetic Analysessupporting
confidence: 86%
“…The core of the taxonomic sampling (Anabantoidei) ( Table S1 online) was built on that of Rüber et al [6], i.e., including the taxa of Anabantoidei sensu Lauder and Liem [25], and the presumed sister group to Anabantoidei, the Channoidei (species of Channa and Parachanna) with the addition of some other representatives of Anabantiformes sensu Betancur-R et al [19] and Collins et al [26], e.g., Badis, Nandus and Dario. Seven nandoid species were designated as the outgroups for analyses based on phylogenetic relationships in [19].…”
Section: Data Collectionmentioning
confidence: 99%
“…From each specimen used in this study, three marker sequences were sequenced: (a) a section of the mitochondrial genome comprising part of the 12S rRNA gene (12S) , the tRNA Val (Val) gene, and a part of the 16S rRNA gene (16S) ; (b) the mitochondrial cytochrome b ( cytb ) gene; and (c) exon 3 of the nuclear recombination activating gene 1 ( rag1 ). The complete cytb gene, approximately 1,200 base pairs (bp), was amplified with primers reported by Collins, Britz, and Rüber (): P10F (5′‐GAAAAACCACCGTTGTTATTCAACTACA‐3′) and P10R 5′‐AGTTTAATTTAGAATYTTRGCTTTGG‐3′). An approximately 2,100‐bp fragment that includes the 3′ end of 12S , the complete Val , and the 5′ end of 16S was amplified by PCR amplification of three overlapping products with primers 12SL (5′‐AAAAAGCTTCAAACTGGGATTAGATACCCCACTAT‐3′) and 12SH (5′‐TGACTGCAGAGGGTGACGGGCGGTGTGT‐3′; Kocher et al, ), Mid_F (5′‐TGAAGGAGGATTTAGCAGTAAG and Mid_R (5′‐AAGTGATTGCGCTACCTTCGCAC‐3′; Rüber, Tassell, & Zardoya, ), and 16S_F2 (5′‐AAGAAGGAACTCGGCAAAC‐3’) (Collins et al, ) and 16S_R (5′‐CCGGTCTGAACTCAGATCACGT‐3′; Palumbi et al, ).…”
Section: Methodsmentioning
confidence: 99%
“…Morphological synapomorphies : RA Collins, R Britz and L Rüber [256].

Badidae

Nandidae

Pristolepididae

…”
Section: Construction and Contentmentioning
confidence: 99%