Phylogenetic Analyses of the Genus Hymenobacter and Description of Siccationidurans gen. nov., and Parahymenobacter gen. nov

Abstract

Phylogenetic analyses of 26 species of the genus Hymenobacter based on the 16S rRNA gene sequences, resulted in polyphyletic clustering with three major groups, arbitrarily named as Clade1, Clade2 and Clade3. Delineation of Clade1 and Clade3 from Clade2 was supported by robust clustering and high bootstrap values of more than 90% and 100% in all the phylogenetic methods. 16S rRNA gene sequence similarity shared by Clade1 and Clade2 was 88 to 93%, Clade1 and Clade3 was 88 to 91% and Clade2 and Clade3 was 89 to 92%. Based on robust phylogenetic clustering, less than 93.0% sequence similarity, unique in silico restriction patterns, presence of distinct signature nucleotides and signature motifs in their 16S rRNA gene sequences, two more genera were carved to accommodate species of Clade1 and Clade3. The name Hymenobacter, sensu stricto, was retained to represent 17 species of Clade2. For members of Clade1 and Clade3, the names Siccationidurans gen. nov. and Parahymenobacter gen. nov. were proposed, respectively, and species belonging to Clade1 and Clade3 were transferred to their respective genera. The genera Hymenobacter (sensu stricto), Siccationidurans gen. nov. and Parahymenobacter gen. nov. contained the signature motifs AAGGCTTTCTGAGTCGTAAA (414-432), and in their 16S rRNA gene sequences, respectively. Further, the genus Hymenobacter was emended and proposed a more acceptable genus description.

Phylogenetic analyses of the genus Glaciecola: emended description of the genus Glaciecola, transfer of Glaciecola mesophila, G. agarilytica, G. aquimarina, G. arctica, G. chathamensis, G. polaris and G. psychrophila to the genus Paraglaciecola gen. nov. as Paraglaciecola mesophila comb. nov., P. agarilytica comb. nov., P. aquimarina comb. nov., P. arctica comb. nov., P. chathamensis comb. nov., P. polaris comb. nov. and P. psychrophila comb. nov., and description of Paraglaciecola oceanifecundans sp. nov.

“…The dissection of the genus Glaciecola was further supported by the presence of signature nucleotides in highly conserved regions of the 16S rRNA gene sequence. Species of clades 1 and 2 can be distinguished by the presence of 18 signature nucleotides (Table 1); the significance of signature nucleotides in the dissection of genera has been highlighted in previous studies describing the genera Planomicrobium (Dai et al, 2005), Sphingosinicella (Maruyama et al, 2006), 'Siccationidurans' and 'Parahymenobacter' (Reddy, 2013) and Aliiglaciecola (Jean et al, 2013). In addition to the existence of these unique nucleotides, members of clade 1 can be distinguished from members of clade 2 by the presence of a signature motif 59-CAAATCAGAATGTTG at positions 1354-1368 (15 nt) in members of clade 2.…”

“…It was also reported previously that the number of nucleotides conserved in the 16S rRNA genes of Gram-negative bacteria is greater than that observed for Gram-positive bacteria. Gram-negative and Gram-positive bacteria contain 713/1542 and 568/1542 nt, respectively, in highly conserved regions (Ludwig et al, 1998;Reddy, 2013), with a total of 145/1542 (9.4 %) more nucleotides conserved in Gram-negative bacteria. Thus, in the present study, a difference of 5.0 % between clades 1 and 2 of the genus Glaciecola (Gram-negative) is large, and warrants the creation of a new genus (Ludwig et al, 1998).…”

“…For instance, based on 16S rRNA gene sequence analyses, five divergent lineages within the genus Bacillus (Ash et al, 1991), two novel orders, Solirubrobacterales and Thermoleophilales (Reddy & Garcia-Pichel, 2009), a new hierarchic classification for actinomycetes (Stackebrandt et al, 1997) and the phylogenetic restructuring of the genus Pseudomonas (Anzai et al, 2000) have been proposed. In agreement with these proposals, the genera 'Siccationidurans' and 'Parahymenobacter' (Reddy, 2013), Pseudoalteromonas (Gauthier et al, 1995) and Shewanella (MacDonell & Colwell, 1985) were established based solely on 16S rRNA gene phylogenetic analyses. The present manuscript deals with phylogenetic analyses of the genus Glaciecola.…”

“…Every single signature nucleotide found was then positioned on the secondary structure of the 16S rRNA gene of E. coli (accession number J01695; obtained from (http://www.rna.icmb.utexas.edu/SIM/4C/ mfold_Eval/accuracy/16s.acc.detailed). This analysis permitted the identification of the signature nucleotides found in terms of single or double compensatory mutations in helices of the secondary structure (Reddy, 2013). Compensatory mutations are two nucleotides that stabilize the stem in a secondary structure (such as G-C or A-T) and are mutated (for example to C-G or T-A) in specific taxa.…”

Hymenobacter ginkgonis sp. nov., isolated from bark of Ginkgo biloba

“…The genus Hymenobacter , family Hymenobacteraceae , class Cytophagia was first proposed by Hirsch et al . [1] and later emended by Buczolite et al [2], Reddy [3] and Han et al [4]. At the time of writing, the genus Hymenobacter consists of 81 species with validly published names (www.bacterio.net).…”