Paper based DNA biosensor for detection of chikungunya virus using gold shells coated magnetic nanocubes

Singhal, Chaitali; Dubey, Amidha; Mathur, Ashish; Pundir, C.S.; Narang, Jagriti

doi:10.1016/j.procbio.2018.08.020

Cited by 59 publications

(33 citation statements)

References 46 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Electrochemical paper analytical device (ePADs) makes a great contribution on the sensor, because of paper being an inexpensive substrate. Singhal et al describe their study about the fabrication of ePADs, by diagnosing the target DNA of Chikungunya virus (CHIKV) [119].…”

Section: Methodsmentioning

confidence: 99%

Electrochemical virus detections with nanobiosensors

Kaya

Karadurmuş

Özçelikay

et al. 2020

Nanosensors for Smart Cities

View full text Add to dashboard Cite

Section: Methodsmentioning

confidence: 99%

Electrochemical virus detections with nanobiosensors

Kaya

Karadurmuş

Özçelikay

et al. 2020

Nanosensors for Smart Cities

View full text Add to dashboard Cite

“…This paper-based biosensor is simple, sensitive, biodegradable, and economic for mass production. The detection of COVID-19 needs to be modified as per the specificity of the virus (Singhal et al 2018 ). Meso/macroporous cobalt (II) oxide nanoflakes based electrochemical biosensor could detect 0.28 ng/μL conc.…”

Section: Future Perspectives Of Biosensors For the Detection Of Sars-mentioning

confidence: 99%

Biosensors: frontiers in rapid detection of COVID-19

2020

View full text Add to dashboard Cite

The rapid community-spread of novel human coronavirus 2019 (nCOVID19 or SARS-Cov2) and morbidity statistics has put forth an unprecedented urge for rapid diagnostics for quick and sensitive detection followed by contact tracing and containment strategies, especially when no vaccine or therapeutics are known. Currently, quantitative real-time polymerase chain reaction (qRT-PCR) is being used widely to detect COVID-19 from various types of biological specimens, which is time-consuming, labor-intensive and may not be rapidly deployable in remote or resource-limited settings. This might lead to hindrance in acquiring realistic data of infectivity and community spread of SARS-CoV-2 in the population. This review summarizes the existing status of current diagnostic methods, their possible limitations, and the advantages of biosensorbased diagnostics over the conventional ones for the detection of SARS-Cov-2. Novel biosensors used to detect RNA-viruses include CRISPR-Cas9 based paper strip, nucleic-acid based, aptamer-based, antigen-Au/Ag nanoparticles-based electrochemical biosensor, optical biosensor, and Surface Plasmon Resonance. These could be effective tools for rapid, authentic, portable, and more promising diagnosis in the current pandemic that has affected the world economies and humanity. Present challenges and future perspectives of developing robust biosensors devices for rapid, scalable, and sensitive detection and management of COVID-19 are presented in light of the test-test-test theme of the World Health Organization (WHO).

show abstract

“… [ 44 ] antibody the surface was functionalized with protein ZIKV E for detection of anti-ZIKV E antibody. [ 104 ] antibody different variants of NS1 [ 47 ] Ebola EBOV Primer forward primer [A/5'-CTA CTG TAT TTC ATA AGA AGA GAG TTG AAC C-3'/5'-AAT TGT TGT TCT ACT GAT CCA CAA GTC TTA C-3'/5'-ATA TGT CCG ACC TTG AAA AAA GGA TTT TTG [FAM-dT][THF][BHQ1-dT] GAC AGT AGT TTT TGC [3'-phosphate]/160 bp]reverse primer [B/5'-CTA CTG AGT CCA GTA TAG AGT CAG AAA TAG TA-3'/5'-CTG AGT TGT TAA GAA TAA TCT CAA TTT GGT-3'/5'-AAT GAC TAC TCC TAG GAT GCT TCT ACC TGT [FAM-dT][THF][BHQ1-dT] GTC AAA ATT CCA TAA [3'-phosphate]/127 bp]probe [C/5'-GAC GAC AAT CCT GGC CAT CAA GAT GAT GAT CC -3'/5'-CGT CCT CGT CTA GAT CGA ATA GGA CCA AGT C -3'/5'-GAT GAT GGA AGC TAC GGC GAA TAC CAG AG [FAM- dT] T [THF] C [BHQ1-dT] CGG AAA ACG GCA TG [3'-phosphate]/168 bp] [ 51 ] primer forward 5'-GTCCGTCGTTCCAGTCATTT-3'reverse 5'-CCCTCTTGGATGCTGAGTTA TG-3'fluorogenic probe 5'-TAAGTGACTCTGCT TGCGGTACAGC-3' [ 5 ] primer used CRISPR-Cas13aCRISPR RNA 5'- GGGGAUUUAGACUACCCCAAAAACGAAGG- GGACUAAAACGUGGCGUCAUCUCCAGCCUUAUCAAUGtarget RNA 5′GAACAUUGAUAAGGCUGGAGAUGACGCC- ACAACAGCUUUGUGAGCUAUUUUCCAUUCAAAAACACU- GGGGGCAUCCUGUGCUACAUAGUGAAACAGCAAU -3' [ 64 ] antibody the surface was functionalized with anti-EBOV [ 105 , 106 ] Chikungunya CHIKV oligonucleotide capture DNA probe 5'-NH2- TGC TCC GCG TCC TTT ACC AA -3'target DNA 5'- TTG GTA AAG GAC GCG GAGCA -3'non-complementary DNA 5'- CTA TGC TTA CAC GTA GAC TGT GC -3' [ 46 ] ...…”

Section: Detection Approaches Using Microfluidic Systemsmentioning

confidence: 99%

Microfluidic devices for the detection of viruses: aspects of emergency fabrication during the COVID-19 pandemic and other outbreaks

2020

View full text Add to dashboard Cite

Extensive testing of populations against COVID-19 has been suggested as a game-changer quest to control the spread of this contagious disease and to avoid further disruption in our social, healthcare and economical systems. Nonetheless, testing millions of people for a new virus brings about quite a few challenges. The development of effective tests for the new coronavirus has become a worldwide task that relies on recent discoveries and lessons learned from past outbreaks. In this work, we review the most recent publications on microfluidics devices for the detection of viruses. The topics of discussion include different detection approaches, methods of signalling and fabrication techniques. Besides the miniaturization of traditional benchtop detection assays, approaches such as electrochemical analyses, field-effect transistors and resistive pulse sensors are considered. For emergency fabrication of quick test kits, the local capabilities must be evaluated, and the joint work of universities, industries, and governments seems to be an unequivocal necessity.

show abstract

Paper based DNA biosensor for detection of chikungunya virus using gold shells coated magnetic nanocubes

Cited by 59 publications

References 46 publications

Electrochemical virus detections with nanobiosensors

Electrochemical virus detections with nanobiosensors

Biosensors: frontiers in rapid detection of COVID-19

Microfluidic devices for the detection of viruses: aspects of emergency fabrication during the COVID-19 pandemic and other outbreaks

Contact Info

Product

Resources

About