OsSLA4 encodes a pentatricopeptide repeat protein essential for early chloroplast development and seedling growth in rice

Wang, Zhongwei; Lv, Jun; Xie, Shu-zhang; Zhang, Yu; Qiu, Zhennan; Chen, Ping; Cui, Yongtao; Niu, Yaofang; Hu, Shikai; Jiang, Hongzhen; Ge, Sheng-zhen; Trinh, HaiPhuong; Lei, Kairong; Bai, Wenqin; Zhang, Yi; Guo, Longbiao; Ren, Deyong

doi:10.1007/s10725-017-0336-6

Cited by 30 publications

(24 citation statements)

References 59 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Quantitative real-time PCR was conducted using a TB Green Premix Ex Taq II (Tli RNa-seH Plus) (TaKaRa) on a Bio-Rad CFX96 system according to the manufacturer's instructions. The genes used for quantitative real-time PCR were consistent with the previous studies (Wang et al 2016b;Zhang et al 2017;Wang et al 2018). OsActin1 and OsUbiquitin were used as double internal controls, and relative transcript levels were analyzed using the 2 -ΔΔCT method (Livak and Schmittgen 2001).…”

Section: Rna Preparation and Quantitative Real-time Pcr Analysismentioning

confidence: 85%

“…A modified tRNA-processing strategy based on the CRISPR/Cas9 system was used for knockout of OsSLC1 in the wild type. The procedures were followed as previously described (Wang et al 2018). Two gRNA target sites (CCGTGGGAGTCCTACGAC CGCGG, CGGTGTCAAGCCGAATACCCCGG) were designed to construct the OsSLC1-Cas9 vector, which was transformed into the wild-type ('Zhonghua 11') calli using an Agrobacterium-mediated method (Hiei and Komari 2008).…”

Section: Vector Construction For the Crispr/cas9 System And Genetic Cmentioning

confidence: 99%

“…A total of 18 intron splicing analysis and 26 C-to-U RNA editing analysis were performed as previously described (Corneille et al 2000;Inada et al 2004;Tan et al 2014;Zhang et al 2017;Wang et al 2018). The RT-PCR primers used for intron splicing and RNA editing analysis were consistent with the previous study (Wang et al 2018). The quantitative real-time PCR primers used for intron splicing and unsplicing analysis were shown in the Supplementary Table S2.…”

Section: Chloroplast Rna Editing and Rna Splicing Analysismentioning

confidence: 99%

“…The chloroplast-localized OsPPR6 is involved in the intron splicing of ycf3 in chloroplasts (Tang et al 2017). The chloroplast-localized OsSLA4 is mainly involved in the intron splicing of atpF, ndhA, petB, rpl2, rpl16, rps12 and trnG in chloroplasts (Wang et al 2018). The chloroplast-localized OsWSL5 is predominantly involved in the intron splicing of rpl2 and rps12 in chloroplasts (Liu et al 2018).…”

Section: Introductionmentioning

confidence: 99%

See 3 more Smart Citations

OsSLC1 Encodes a Pentatricopeptide Repeat Protein Essential for Early Chloroplast Development and Seedling Survival

Shang

Chen

et al. 2020

Rice

Self Cite

View full text Add to dashboard Cite

Background: The large family of pentatricopeptide repeat (PPR) proteins is widely distributed among land plants. Such proteins play vital roles in intron splicing, RNA editing, RNA processing, RNA stability and RNA translation. However, only a small number of PPR genes have been identified in rice. Results: In this study, we raised a mutant from tissue-culture-derived plants of Oryza sativa subsp. japonica 'Zhonghua 11', which exhibited a lethal chlorosis phenotype from germination to the third-leaf stage. The mutant was designated seedling-lethal chlorosis 1 (slc1). The slc1 mutant leaves showed extremely low contents of photosynthetic pigments and abnormal chloroplast development, and were severely defective in photosynthesis. Map-based cloning of OsSLC1 revealed that a single base (G) deletion was detected in the first exon of Os06g0710800 in the slc1 mutant, which caused a premature stop codon. Knockout and complementation experiments further confirmed that OsSLC1 is responsible for the seedling-lethal chlorosis phenotype in the slc1 mutant. OsSLC1 was preferentially expressed in green leaves, and encoded a chloroplast-localized PPR protein harboring 12 PPR motifs. Loss-of-function of OsSLC1 affected the intron splicing of multiple group II introns, and especially precluded the intron splicing of rps16, and resulted in significant increase in the transcript levels of 3 chloroplast ribosomal RNAs and 16 chloroplast development-related and photosynthesis-related genes, and in significant reduction in the transcript levels of 1 chloroplast ribosomal RNAs and 2 chloroplast development-related and photosynthesis-related genes. Conclusion: We characterized a novel chloroplast-localized PPR protein, OsSLC1, which plays a vital role in the intron splicing of multiple group II introns, especially the rps16 intron, and is essential for early chloroplast development and seedling survival in rice.

show abstract

Section: Rna Preparation and Quantitative Real-time Pcr Analysismentioning

confidence: 85%

Section: Vector Construction For the Crispr/cas9 System And Genetic Cmentioning

confidence: 99%

Section: Chloroplast Rna Editing and Rna Splicing Analysismentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

OsSLC1 Encodes a Pentatricopeptide Repeat Protein Essential for Early Chloroplast Development and Seedling Survival

Shang

Chen

et al. 2020

Rice

Self Cite

View full text Add to dashboard Cite

show abstract

“…Most of the existing rice mutants displaying altered leaf color are due to mutations in genes related to chloroplast development or metabolism (Zhang and Gao 2009;Yang et al 2016, Su et al 2017. These rice leaf color mutations result in decrease of photosynthetic efficiency and crop production Ge et al 2015), and in severe cases can even lead to plant death (Wang et al 2018). Recently, leaf color mutants have become useful models for studying physiological and metabolic processes such as chlorophyll metabolism, leaf color breeding, disease resistance, and chloroplast structure, function and development.…”

Section: Introductionmentioning

confidence: 99%

Genetic analysis and fine-mapping of a new rice mutant, white and lesion mimic leaf1

Chen

et al. 2018

Plant Growth Regul

Self Cite

View full text Add to dashboard Cite

Rice (Oryza sativa L.) leaf color mutants are excellent models for studying chlorophyll biosynthesis and chloroplast development. In this study, we isolated a stable genetic white and lesion mimic leaf1 (wlml1) mutant from an ethyl methanesulfonate (EMS)-mutagenized population of the indica cultivar TN1. Compared with wild-type TN1, the wlml1 mutant had lower contents of chlorophyll and carotenoids, altered chloroplast ultrastructure, and altered regulation of genes associated with chlorophyll metabolism and chloroplast development. In addition, lesions formed on the leaves of wlml1 plants grown at 20 °C and genes related to disease resistance and antioxidant functions were up-regulated; by contrast, the mutant phenotype was partially suppressed at 28 °C. These findings indicated that WLML1 might play a role in chlorophyll metabolism and chloroplast development, as well as in biotic and abiotic stress responses. Genetic analysis showed that WLML1 was controlled by a recessive nuclear gene, and map-based cloning delimited WLML1 to a 159.7-kb region on chromosome 4 that includes 30 putative open reading frames. Based on these findings, the wlml1 mutant will be a good genetic material for further studies on chlorophyll metabolism and stress responses in rice.

show abstract

Fine mapping and identification of a novel albino gene OsAL50 that is required for chlorophyll biosynthesis and chloroplast development in rice (Oryza sativa L.)

Zeng,

Wei,

Xiao

et al. 2024

Plant Growth Regul

View full text Add to dashboard Cite

OsSLA4 encodes a pentatricopeptide repeat protein essential for early chloroplast development and seedling growth in rice

Cited by 30 publications

References 59 publications

OsSLC1 Encodes a Pentatricopeptide Repeat Protein Essential for Early Chloroplast Development and Seedling Survival

OsSLC1 Encodes a Pentatricopeptide Repeat Protein Essential for Early Chloroplast Development and Seedling Survival

Genetic analysis and fine-mapping of a new rice mutant, white and lesion mimic leaf1

Fine mapping and identification of a novel albino gene OsAL50 that is required for chlorophyll biosynthesis and chloroplast development in rice (Oryza sativa L.)

Contact Info

Product

Resources

About