Oomycetes associated with strawberry diseases in Corrientes, Argentina

Ibañez, J.M.; Favaro, María Alejandra; Obregón, V.G.; Lattar, T.E.

doi:10.1016/j.cropro.2022.105967

Cited by 2 publications

(1 citation statement)

References 15 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…PCR was carried out using primers which a code for a segment of the internal transcribed spacer (ITS) region of ribosomal nuclear: ITS-1 (5' TCCGTAGGTGAACCTGCGG 3') and ITS-4 (5' TCCTCCGCTTATTGATATGC 3'). The obtained products were observed on a 1.5% agarose gel in 1x TAE buffer by electrophoresis and after running, the gel was visualised under ultraviolet light (UV) using a UV transilluminator (MLB -21, MAESTROGEN) (Ibañez et al, 2022).…”

Section: Molecular Characterisationmentioning

confidence: 99%

In vitro susceptibility test of Cladosporium cladosporioides isolates from Argentinian tomato crops against commercial fungicides

Machuca,

Acuña Ojeda,

Alfaro

et al. 2023

J. Hortic. Sci.

Self Cite

View full text Add to dashboard Cite

Tomato cultivation is an important agricultural activity in northeast of Argentina, and disease control is indispensable for its production. The purpose of the current study was to identify two fungi isolated from tomato plants cultivated in greenhouses, with symptoms of leaf mould disease and a strain of the genus Cladosporium from a culture collection, and evaluate their in vitro susceptibility to four commercial fungicides. Macro and microscopic examination, molecular characterisation and sequence analysis were applied for identification. Broth dilution and spread plate methods were used to determine the minimal inhibitory concentration (MIC) and minimal fungicide concentration (MFC). The active ingredients of the products were azoxystrobin+difenoconazole, trifloxystrobin+tebuconazole, chlorothalonil and metalaxyl-M+mancozeb. The results were processed using the Kruskal-Wallis method. The isolates were identified as Cladosporium cladosporioidesa-c; consequently, lesions found on tomato plants did not corrspond to Cladosporium fulvum. There was a significant statistical difference between the obtained values. Qualitatively, the three strains had a similar behaviour for chlorothalonil (MIC values: 0.25 - 0.5 μg/ml, MFC values: 4 μg/ml). In all cases, tests with metalaxyl-M+mancozeb yielded higher values than those achieved for chlorothalonil (MIC values: 8 μg/ml, MFC values: 8- 32 μg/ml). trobilurin-formulated fungicides were less effective against C. cladosporioidesa-b (MIC values: 16-256 μg/ml, MFC values: >64 μg/ml). C. cladosporioidesc was the most sensitive isolate. The information about the presence of a non-frequent fungus and its fungicide susceptibility, would be useful for establishing control strategies and enhance production.

show abstract

Section: Molecular Characterisationmentioning

confidence: 99%

In vitro susceptibility test of Cladosporium cladosporioides isolates from Argentinian tomato crops against commercial fungicides

Machuca,

Acuña Ojeda,

Alfaro

et al. 2023

J. Hortic. Sci.

Self Cite

View full text Add to dashboard Cite

show abstract

A Diagnostic Guide to Phytopythium helicoides and Phytopythium vexans Causing Root and Crown Rot Diseases

Ghimire

Baysal-Gurel

2023

Plant Health Progress

View full text Add to dashboard Cite

Phytopythium was initially grouped with closely related species of the Pythium group, which German botanist Nathanael Pringsheium first described in 1858. Later with the progress in studies of this group, the clade K (Ovatisporagnium) of the genus Pythium was concluded to be more closely related to the genus Phytophthora than Pythium. Ovatisporangium in the Pythium group was then replaced by the term Phytopythium. Hence, the genus Phytopythium is relatively new and is different from Pythium (Bala et al. 2010; Lodhi et al. 2020; Tkaczyk 2020). It exhibits intermediate morphological features between Phytophthora and Pythium but is unique in having internally proliferating papillate sporangia and cylindrical or lobate antheridia (De Cock et al. 2015). Phytopythium helicoides (Abad, De Cock, Bala, Robideau, Lodhi & Levesque) and Phytopythium vexans (Abad, De Cock, Bala, Robideau, Lodhi & Levesque) are two closely related emerging oomycete plant pathogens in the Phytopythium group. Several other names have been provided to P. helicoides in the past such as Pythium helicoides (Drechsler 1930) and Ovatisporangium helicoides (Azizi et al. 2013) whereas P. vexans (Ivors et al. 2008) was called Pythium vexans and Ovatisporangium vexans (Uzuhashi et al. 2010).

show abstract

Oomycetes associated with strawberry diseases in Corrientes, Argentina

Cited by 2 publications

References 15 publications

In vitro susceptibility test of Cladosporium cladosporioides isolates from Argentinian tomato crops against commercial fungicides

In vitro susceptibility test of Cladosporium cladosporioides isolates from Argentinian tomato crops against commercial fungicides

A Diagnostic Guide to Phytopythium helicoides and Phytopythium vexans Causing Root and Crown Rot Diseases

Contact Info

Product

Resources

About