: We have found that, in the presence of a thermophilic restriction endonuclease, thermophilic DNA polymerase efficiently synthesizes and amplifies DNA in the absence of any added template and primer nucleic acid under isothermal conditions. More than 10 µg of DNA can be synthesized by 1 unit of DNA polymerase in 1 h, and the reaction proceeds until available dNTPs are consumed. We used mostly the Tsp509I restriction endonuclease (recognition sequence: VAATT), the TspRI restriction endonuclease (recognition sequence: NNCA(G/C)TGNNV), and Vent (exo -) and Vent DNA polymerase. The synthesized double-stranded DNA has a highly repetitive palindromic sequence, e.g. (AAAAATTTTT) n and (ATACACTGTATATACAGTGTAT) n . In every repeating unit, there are one or two recognition sites for the restriction enzyme. Our data show that the high efficiency of the restriction-endonuclease-DNApolymerase (RE-pol) DNA synthesis results from an efficient exponential amplification involving digestionelongation cycles: a longer DNA with numerous recognition sites for the restriction enzyme is digested to short fragments, and the short fragments are used as seeds for elongation to synthesize longer DNA. A possible role of RE-pol DNA synthesis in the evolutionary development of genetic materials is briefly discussed.For all organisms, genetic information is carried by long DNA. Even the smallest genomic DNA found in mycoplasma genitalium is 580 kb in length (1). How is the long DNA synthesized in the primordial environment? This is an interesting but extremely difficult question because the first long DNA synthesis happened billions of years ago. Recently more and more tandem repetitive DNA sequences have been found in many organisms (2-8). Furthermore, many repetitive short DNA sequences can be elongated to more than 50-kilobase pairs in length by DNA polymerase (9-15). Thus, short repetitive DNA sequences are believed to be served as one of the origins of large genomic DNA in modern organisms. Ohno proposed that modern coding sequences of DNA evolved from primordial oligomeric repeats and these repeats were elongated progressively during the course of evolution (16-19).Ogata and Miura found that 10-50 knt 1 DNA could be ab initio (i.e. in the absence of any initial nucleic acid) synthesized from dNTPs by thermophilic DNA polymerases (from archaea Thermococcus litoralis and archaea Thermus thermophilus, etc.) (20-22). The synthesized double-stranded DNA had a repetitive and palindromic sequence, like (TACATGTA) n , and similar sequences were found in the genomes of many organisms (20,21). The authors claimed that the tandem repetitive structure in many genes might have been arisen by the ab initio DNA synthesis but not by gene duplication as commonly believed (22). They imagined that a primitive polypeptide having polymerase-like activity synthesized long stretches of DNAs with simple repetitive sequences, which are gradually "evolved" into degenerate sequences by accumulating mutations during the error-prone replication by primor...