Nutritional Quality during Development Alters Insulin-Like Peptides’ Expression and Physiology of the Adult Yellow Fever Mosquito, Aedes aegypti

Abstract

Mosquitoes have distinct developmental and adult life history, and the vectorial capacity of females has been shown to be affected by the larval nutritional environment. However, little is known about the effect of developmental nutrition on insulin-signaling and nutrient storage. In this study, we used Aedes aegypti, the yellow fever mosquito, to determine whether larval nutrition affects insulin gene expression. We also determined the traits regulated by insulin signaling, such as stored-nutrient levels and fecundity. We raised mosquito larvae on two different diets, containing either high protein or high carbohydrates. Development on a high-carbohydrate diet resulted in several life-history phenotypes indicative of suboptimal conditions, including increased developmental time and decreased fecundity. Additionally, our data showed that insulin transcript levels are affected by a high-carbohydrate diet during development. Females, not males, reared on high-carbohydrate diets had much higher transcript levels of insulin-like peptide 3 (ILP3), a mosquito equivalent of human insulin, and these females more readily converted sugar meals into lipids. We also found that AaILP4, not AaILP3, transcript levels were much higher in the males after a sugar meal, suggesting sex-specific differences in the insulin-signaling pathway. Our findings suggest a conserved mechanism of carbohydrate-mediated hyperinsulinemia in animals.

Effects of Non-Lethal High-Temperature Stress on Bradysia odoriphaga (Diptera: Sciaridae) Larval Development and Offspring

“…The hatchability of Plutella xylostella offspring decreased by 20% when adults experienced natural high temperature for 1 d [41]. This phenomenon was also observed in Grapholitha molesta [36]. However, our study found that there was no significant effect on the oviposition amount and egg hatching rate for adults resulting from high-temperature-stressed larvae ( Figure 5A,B), which suggests that high-temperature stress only affected the contemporary growth and development of B. odoriphaga and had no effect on offspring.…”

“…The longevity of male and female adults depends on the insect species [36] and its reproductive characteristics [37]. Since living requires energy consumption, insects can extend their lifespan by obtaining energy from nature [38].…”

The sugar substitute Stevia shortens the lifespan of Aedes aegypti potentially by N-linked protein glycosylation

“…Eggs were hatched overnight in small plastic cups with deionized water. First instar larvae were counted (150 per pan) and reared in 500 ml of deionized water on a powdered fish food diet (Tetramin ® , Melle, Germany) as described in detail by Pooraiiouby et al 30 . Pupae were collected from rearing pans and were transferred to adult emergence cages.…”

“…Two mosquitoes per sample were collected in triplicate at each time point per treatment. Samples were processed for micro-separation of metabolites from both males and females according to previously established protocols 30 . Levels of trehalose and glycogen were estimated using the anthrone assay and lipids were measured with a vanillin assay 29 .…”

“…Gene-specific primers for mannose-1-phosphate guanyltransferase were designed (AaM1-PGT Fwd: 5′TATGGGAACGGAAGCAACCC3′ and AaM1-PGTRev: 5′ACGTACACGCCACAGTTGAT3′). A ribosomal protein S7 gene was used as a housekeeping control 30 . Relative expression was calculated using the 2 −ΔΔCt method.…”