New heterologous modules for classical or PCR‐based gene disruptions in Saccharomyces cerevisiae

Abstract

We have constructed and tested a dominant resistance module, for selection of S. cerevisiae transformants, which entirely consists of heterologous DNA. This kanMX module contains the known kanr open reading-frame of the E. coli transposon Tn903 fused to transcriptional and translational control sequences of the TEF gene of the filamentous fungus Ashbya gossypii. This hybrid module permits efficient selection of transformants resistant against geneticin (G418). We also constructed a lacZMT reporter module in which the open reading-frame of the E. coli lacZ gene (lacking the first 9 codons) is fused at its 3' end to the S. cerevisiae ADH1 terminator. KanMX and the lacZMT module, or both modules together, were cloned in the center of a new multiple cloning sequence comprising 18 unique restriction sites flanked by Not I sites. Using the double module for constructions of in-frame substitutions of genes, only one transformation experiment is necessary to test the activity of the promotor and to search for phenotypes due to inactivation of this gene. To allow for repeated use of the G418 selection some kanMX modules are flanked by 470 bp direct repeats, promoting in vivo excision with frequencies of 10(-3)-10(-4). The 1.4 kb kanMX module was also shown to be very useful for PCR based gene disruptions. In an experiment in which a gene disruption was done with DNA molecules carrying PCR-added terminal sequences of only 35 bases homology to each target site, all twelve tested geneticin-resistant colonies carried the correctly integrated kanMX module.

The histone methylase Set2p and the histone deacetylase Rpd3p repress meiotic recombination at the HIS4 meiotic recombination hotspot in Saccharomyces cerevisiae

“…Derivatives of AS4 and AS13 are listed in Table 1; diploids constructed by crossing AS4 and AS13 derivatives are described in Table 2. Deletions were constructed by replacing the relevant gene with a kanMX4 cassette (43) or hphMX4 cassette (44), which contain a gene that confers geneticin or hygromycin resistance, respectively. The PCR synthesis of the cassettes and subsequent transformation were performed as described by Wach et al (43), using the plasmid pFA6-kanMX4 (kanMX4 cassette; 43) or pAG32 (hphMX4 cassette; 44) and the primer pairs listed in Table 3.…”

“…Sequence (5′-3′) TTCCATAGCCGGTAAGAAGG a Gene deletions were made using PCR fragments containing a selectable marker flanked by sequences from the gene to be deleted (43,44). For most of these constructions, the sequences of the oligonucleotides match those located immediately upstream and downstream of the gene to be deleted.…”

Mutants defective in secretory/vacuolar pathways in the EUROFAN collection of yeast disruptants

“…These strains carry deletions in which a cassette containing the kanMX4 marker replaces the deleted open reading frame, these deletions being made in the FY1679 genetic background (Wach et al, 1994). We used, for the primary screen, the complete collection of strains in MATa mating type (strains FY10001B-FY10796B; the list of corresponding ORFs can be found at the MIPS web site, http://mips.gsf.de/).…”

“…These ORFs were found to include 149 essential genes. In the first part of the EUROFAN program, screens were developed to identify the function of non-essential genes by checking the phenotypes of the corresponding deletants, constructed by a PCR-mediated gene replacement approach (Wach et al, 1994). The 'secretory and protein trafficking node' of EURO-FAN brought together six groups, including our own, that developed various assays to uncover, within the whole collection for non-essential genes, those that were potentially involved in the secretory/vacuolar/endocytic pathways.…”

Biofilm formation and toxin production provide a fitness advantage in mixed colonies of environmental yeast isolates

“…The diploid isolates were transformed using a lithium acetate procedure (Gietz & Woods, 2002) with a cassette that targeted the terminal region of the highly expressed PGK1 gene (Figure S2) and contained: (1) either mCherry or GFP, and (2) antibiotic resistance through KanMX (Wach, Brachat, Pohlmann, & Philippsen, 1994), NatMX or HphMX (Goldstein & McCusker, 1999). Plasmids pFA6a‐GFP‐KanMX6 (Longtine et al., 1998) and pBS34‐mCherry‐KanMX6 (Hailey, Davis, & Muller, 2002) were digested with NotI and used as template for PCR (Yeast Resource Center, University of Washington).…”