Nanoparticle Encapsidation of Flock House Virus by Auto Assembly of Tobacco Mosaic Virus Coat Protein

Abstract

Tobacco Mosaic virus (TMV) coat protein is well known for its ability to self-assemble into supramolecular nanoparticles, either as protein discs or as rods originating from the ~300 bp genomic RNA origin-of-assembly (OA). We have utilized TMV self-assembly characteristics to create a novel Flock House virus (FHV) RNA nanoparticle. FHV encodes a viral polymerase supporting autonomous replication of the FHV genome, which makes it an attractive candidate for viral transgene expression studies and targeted RNA delivery into host cells. However, FHV viral genome size is strictly limited by native FHV capsid. To determine if this packaging restriction could be eliminated, FHV was adapted to express enhanced green fluorescent protein (GFP), to allow for monitoring of functional FHV RNA activity. Then TMV OA was introduced in six 3' insertion sites, with only site one supporting functional FHV GFP expression. To create nanoparticles, FHV GFP-OA modified genomic RNA was mixed in vitro with TMV coat protein and monitored for encapsidation by agarose electrophoresis and electron microscopy. The production of TMV-like rod shaped nanoparticles indicated that modified FHV RNA can be encapsidated by purified TMV coat protein by self-assembly. This is the first demonstration of replication-independent packaging of the FHV genome by protein self-assembly.

In planta Production of Flock House Virus Transencapsidated RNA and Its Potential Use as a Vaccine

“…The advantages of FHV include a bipartite genome, where the polymerase is encoded by the independently replicating RNA 1 and the structural capsid gene is encoded by RNA 2, allowing for easy manipulation of the RNA1 genome for vaccine development and the separation of replication from packaging. We have already tested in vitro assembled TMV-FHV particles and have shown that TMV Oa did not disrupt FHV viral replication, using an enhanced green fluorescent protein (eGFP) transgene to monitor replication and expression in mammalian cells (23). However, the limitations of in vitro encapsidation remain with this system; namely the cost of RNA synthesis and potentially reduced translation due to inefficient in vitro 5' capping.…”

Engineered Flock House Virus for Targeted Gene Suppression Through RNAi in Fruit Flies (Drosophila melanogaster) in Vitro and in Vivo

“…A plasmid (pMT/V5-His A) containing the full FHV RNA1 genome and a ribozyme sequence derived from hepatitis delta virus (HDV) attached to its 3′ end was kindly provided by Professor Ronald Van Rij (Radboud Institute for Molecular Life Sciences, Nijmegen, Netherlands) ( Figure 2A ). Based on Maharaj et al (2014) , an insertion site was created at position 3037 bp of the pMT-FHV RNA1 genome for the introduction of the reporter gene ( eGFP ) and subsequently a D. melanogaster target gene sequence for dsRNA production during viral replication. First, a polylinker, ATGCATGCGATCGCTGTACA, composed of three restriction sites, NsiI, AsiSI, and BsrGI was inserted into position 3037 bp of the pMT-FHV RNA1 genome ( Figure 2B ).…”

Plant Virus Expression Vectors: A Powerhouse for Global Health

“…By including origins of assembly (ori) from TMV into the Flock house virus genome, a pseudovirus consisting of the FHV genome encapsidated by TMV coat protein was generated. Since TMV behaves like an adjuvant and can stimulate an immune response, this pseudovirus approach can be used to produce novel vaccines from plants [ 80 ].…”