N‐terminal domain of Pyrococcus furiosus l‐asparaginase functions as a non‐specific, stable, molecular chaperone

Abstract

The enzyme L-asparaginase of Pyrococcus furiosus (PfA) functions as a dimer with each monomer consisting of distinct N-and C-terminal domains (NPfA and CPfA, respectively), connected by a linker. Here we present data to show that NPfA functions as a non-specific molecular chaperone. Independently expressed NPfA refolded spontaneously whereas CPfA formed insoluble aggregates. However, when mixed and refolded together, NPfA augmented CPfA to fold with~90% recovery. NPfA also protected a variety of substrate proteins from thermal and refolding-mediated aggregation as monitored by a reduction in light scattering. The co-appearance of substrate protein with NPfA in antibody pull-down assays as well as in eluted gel filtration peaks indicated direct protein-protein interaction. These interactions were hydrophobic in nature as determined by 8-anilino-1-naphthalene sulfonic acid fluorescence. NPfA inhibited polyglutamine-mediated amyloid formation and also facilitated disintegration of preformed amyloid fibrils of amyloid-b (1-42) as determined by reverse-phase HPLC-based sedimentation assay and thioflavin T binding assays, respectively. Dynamic light scattering experiments suggested that NPfA readily assembled into polydispersed oligomeric species. With no sequence similarity to a-crystallin or any known molecular chaperone, we present here NPfA as a novel molecular chaperone. Structured digital abstract• Ab amyloid 1-42 and Ab amyloid 1-42 bind by fluorescence technology (View interaction)• alpha-amylase and alpha-amylase bind by light scattering (View interaction)• Ab amyloid 1-42 and Ab amyloid 1-42 bind by transmission electron microscopy (View interaction)• NPfa binds to BCA II by anti tag coimmunoprecipitation (View interaction)• MSG and MSG bind by light scattering (View interaction)

Structural and functional insights into an archaealL-asparaginase obtained through the linker-less assembly of constituent domains

“…S1 and Supplementary Table S1 1 ). This, together with our earlier finding that the N-terminal domain of PfA is actually involved in the overall folding of the protein (Tomar et al, 2013), led us to speculate that the linker of PfA may have a rather insignificant role. Thus, to evaluate whether the domains of PfA can function in isolation, or in a certain combination, without the Sequence and structural comparison of bacterial and archaeal l-asparaginases.…”

Domains of Pyrococcus furiosus l-asparaginase fold sequentially and assemble through strong intersubunit associative forces

“…In addition, the thermodynamic parameters clearly placed NPfA as the more stable partner (Table 1). This information along with our previous finding that the N-domain acts as a folding assistance to the C-terminal domain made us to conclude that in the case of PfA the domains fold sequentially; N-domain folds first followed by the C-domain (Tomar et al 2013). 3).…”

“…PCR-based site-directed mutagenesis was carried out using primer 5′CTTATCCAGCCAGAAG ATTTTGTAGATCTTGCTGAAAC3′ and its complement, and primer 5′ACAGTAACAAAGCTCATGTTTATTCTAG GCCACACAA3′ and its complementary pair for obtaining W60F (N-terminal Trp mutant) and W301F (C-terminal Trp mutant), respectively. All the proteins were purified by standard Ni-NTA-affinity procedure explained elsewhere (Bansal et al 2012;Tomar et al 2013Tomar et al , 2014. Transformed E. coli cells (Rosetta DE3), grown by shaking at 37 °C in LB medium (HiMedia) containing 50 µg ml −1 kanamycin and 17 µg ml −1 chloramphenicol (Sigma), were induced with 1 mM IPTG (Sigma) (at A 600 of 0.6) and harvested 14 h post-induction by centrifugation, followed by sonication.…”

Role of N-terminal region of Escherichia coli maltodextrin glucosidase in folding and function of the protein

“…Based on various reports indicating isolated protein domains having internal chaperonin activities [48,49], attempts to fold the truncated MalZ in presence of the [50], it can also result in enhancement of function for the protein [51,52]. The Nterminal may play an active role in the catalytic activity as it has been reported in case for some amylases that N-terminal binds to starch or pullalan and may help in catalytic activity [53].…”