Multiplex assay to identify Korean vectors of malaria

Joshi, Deeksha; Park, M. H.; Saeung, Atiporn; Choochote, Wej; Min, Gi–Sik

doi:10.1111/j.1755-0998.2010.02835.x

Cited by 41 publications

(39 citation statements)

References 5 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Molecular identifications of An. sinensis species were done by using species-specific primers and amplification of the ITS2 and 28S rDNA regions (D1 and D2) [38]. A total of 100 mosquitoes per site were randomly selected and tested molecularly, and all of them identified as An.…”

Section: Methodsmentioning

confidence: 99%

Multiple Resistances and Complex Mechanisms of Anopheles sinensis Mosquito: A Major Obstacle to Mosquito-Borne Diseases Control and Elimination in China

et al. 2014

View full text Add to dashboard Cite

Malaria, dengue fever, and filariasis are three of the most common mosquito-borne diseases worldwide. Malaria and lymphatic filariasis can occur as concomitant human infections while also sharing common mosquito vectors. The overall prevalence and health significance of malaria and filariasis have made them top priorities for global elimination and control programmes. Pyrethroid resistance in anopheline mosquito vectors represents a highly significant problem to malaria control worldwide. Several methods have been proposed to mitigate insecticide resistance, including rotational use of insecticides with different modes of action. Anopheles sinensis, an important malaria and filariasis vector in Southeast Asia, represents an interesting mosquito species for examining the consequences of long-term insecticide rotation use on resistance. We examined insecticide resistance in two An. Sinensis populations from central and southern China against pyrethroids, organochlorines, organophosphates, and carbamates, which are the major classes of insecticides recommended for indoor residual spray. We found that the mosquito populations were highly resistant to the four classes of insecticides. High frequency of kdr mutation was revealed in the central population, whereas no kdr mutation was detected in the southern population. The frequency of G119S mutation in the ace-1 gene was moderate in both populations. The classification and regression trees (CART) statistical analysis found that metabolic detoxification was the most important resistance mechanism, whereas target site insensitivity of L1014 kdr mutation played a less important role. Our results indicate that metabolic detoxification was the dominant mechanism of resistance compared to target site insensitivity, and suggests that long-term rotational use of various insecticides has led An. sinensis to evolve a high insecticide resistance. This study highlights the complex network of mechanisms conferring multiple resistances to chemical insecticides in mosquito vectors and it has important implication for designing and implementing vector resistance management strategies.

show abstract

Section: Methodsmentioning

confidence: 99%

Multiple Resistances and Complex Mechanisms of Anopheles sinensis Mosquito: A Major Obstacle to Mosquito-Borne Diseases Control and Elimination in China

et al. 2014

View full text Add to dashboard Cite

show abstract

“…Molecular identifications of An. sinensis species were conducted by using species-specific primers targeting amplification of the ITS2 and 28S rDNA regions (D1 and D2) [30]. To determine point mutations of the kdr gene at position 1014, we amplified a 325 bp fragment, using the primer pair: kdr -F TGCCACTCCGTGTGTTTAGA, and kdr -R GAGCGATGATGATCCGAAAT.…”

Section: Methodsmentioning

confidence: 99%

Anopheles sinensis mosquito insecticide resistance: comparison of three mosquito sample collection and preparation methods and mosquito age in resistance measurements

Zhong

Tang

et al. 2014

Parasites Vectors

View full text Add to dashboard Cite

BackgroundInsecticide resistance monitoring in malaria mosquitoes is essential for guiding the rational use of insecticides in vector control programs. Resistance bioassay is the first step for insecticide monitoring and it lays an important foundation for molecular examination of resistance mechanisms. In the literature, various mosquito sample collection and preparation methods have been used, but how mosquito sample collection and preparation methods affect insecticide susceptibility bioassay results is largely unknown. The objectives of this study were to determine whether mosquito sample collection and preparation methods affected bioassay results, which may cause incorrect classification of mosquito resistance status.MethodsThe study was conducted in Anopheles sinensis mosquitoes in two study sites in central China. Three mosquito sample collection and preparation methods were compared for insecticide susceptibility, kdr frequencies and metabolic enzyme activities: 1) adult mosquitoes collected from the field; 2) F1 adults from field collected, blood-fed mosquitoes; and 3) adult mosquitoes reared from field collected larvae.ResultsMosquito sample collection and preparation methods significantly affected mortality rates in the standard WHO tube resistance bioassay. Mortality rate of field-collected female adults was 10-15% higher than in mosquitoes reared from field-collected larvae and F1 adults from field collected blood-fed females. This pattern was consistent in mosquitoes from the two study sites. High kdr mutation frequency (85-95%) with L1014F allele as the predominant mutation was found in our study populations. Field-collected female adults consistently exhibited the highest monooxygenase and GST activities. The higher mortality rate observed in the field-collected female mosquitoes may have been caused by a mixture of mosquitoes of different ages, as older mosquitoes were more susceptible to deltamethrin than younger mosquitoes.ConclusionsFemale adults reared from field-collected larvae in resistance bioassays are recommended to minimize the effect of confounding factors such as mosquito age and blood feeding status so that more reliable and reproducible mortality may be obtained.

show abstract

“…kleini were established successfully using the methods of [28]. An F 1 -progeny of each iso-female line was used for species identification following the keys of [29] as well as a molecular assay [30]. Then, one iso-female line of each species, with molecular identification of both nuclear (ITS2) and mitochondrial (COI) genes, were well matched with those in the GenBank nucleotide sequence database, and selected, i.e., An.…”

Section: Methodsmentioning

confidence: 99%

“…Primers for the amplification of ITS2 and COI regions followed a previous report by [30]. The ITS2 region of the rDNA was amplified using the ITS2 Forward and ANO 28S-20 primers [30,32].…”

Section: Methodsmentioning

confidence: 99%

“…Primers for the amplification of ITS2 and COI regions followed a previous report by [30]. The ITS2 region of the rDNA was amplified using the ITS2 Forward and ANO 28S-20 primers [30,32]. The mitochondrial COI gene was amplified using the LCO1490 (5′-GGT CAA CAA ATC ATA AAG ATA TTG G-3′) and HCO2198 (5′-TAA ACT TCA GGG TGA CCA AAA AAT CA-3′) primers of [33].…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Evidence to support natural hybridization between Anopheles sinensis and Anopheles kleini (Diptera: Culicidae): possibly a significant mechanism for gene introgression in sympatric populations

Choochote

Min

Intapan

et al. 2014

Parasites & Vectors

View full text Add to dashboard Cite

BackgroundMalaria caused by Plasmodium vivax is still a public health problem in the Republic of Korea (ROK), particularly regarding the recent re-emergence of this malarial species near the demilitarized zone in northwestern Paju City, Gyeonggi-do Province. Currently, at least 4 species (An. kleini, An. pullus, An. belenrae and An. lesteri) of the Hyrcanus Group are reported as possible natural vectors of vivax malaria in the ROK, and An. sinensis, which is the most dominant species, has long been incriminated as an important natural vector of this P. vivax. However, An. sinensis was ranked recently as a low potential vector. According to the discovery of natural hybrids between An. sinensis (a low potential vector for P. vivax) and An. kleini (a high potential vector for P. vivax) in Paju City, intensive investigation of this phenomenon is warranted under laboratory conditions.MethodsMosquitoes were collected during 2010-2012 from Paju City, ROK. Hybridization experiments used iso-female line colonies of these anophelines together with DNA analysis of ribosomal DNA [second internal transcribed spacer (ITS2)] and mitochondrial DNA [cytochrome c oxidase subunit I (COI)] of the parental colonies, F1-hybrids and repeated backcross progenies were performed intensively by using a PCR-based assay and pyrosequencing technology.ResultsThe results from hybridization experiments and molecular investigations revealed that the mitochondrial COI gene was introgressed from An. sinensis into An. kleini. The An. sinensis progenies obtained from consecutive repeated backcrosses in both directions, i.e., F2-11 progeny [(An. sinensis x An. kleini) x An. sinensis] and F3-5 progeny [(An. kleini x An. sinensis) x An. kleini] provided good supportive evidence.ConclusionsThis study revealed introgression of the mitochondrial COI gene between An. sinensis and An. kleini through consecutive repeated backcrosses under laboratory conditions. This new body of knowledge will be emphasized in reliable promising strategies in order to replace the population of An. kleini as a high potential vector for P. vivax, with that of a low potential vector, An. sinensis, through the mechanism of gene introgression in nature.

show abstract

Multiplex assay to identify Korean vectors of malaria

Cited by 41 publications

References 5 publications

Multiple Resistances and Complex Mechanisms of Anopheles sinensis Mosquito: A Major Obstacle to Mosquito-Borne Diseases Control and Elimination in China

Multiple Resistances and Complex Mechanisms of Anopheles sinensis Mosquito: A Major Obstacle to Mosquito-Borne Diseases Control and Elimination in China

Anopheles sinensis mosquito insecticide resistance: comparison of three mosquito sample collection and preparation methods and mosquito age in resistance measurements

Evidence to support natural hybridization between Anopheles sinensis and Anopheles kleini (Diptera: Culicidae): possibly a significant mechanism for gene introgression in sympatric populations

Contact Info

Product

Resources

About