Multiple Resistance to Glyphosate and Acetolactate Synthase Inhibitors in Palmer Amaranth (Amaranthus palmeri) Identified in Brazil

Abstract

Palmer amaranth is native to the United States, but was discovered in 2015 in Brazil. Palmer amaranth populations in Brazil were very difficult to control using glyphosate, which resulted in many changes to standard weed management practices. A genotyping assay was used to confirm that the population detected in Mato Grosso State, Brazil, was correctly identified as Palmer amaranth and that it was not tall waterhemp. Greenhouse dose–response curves and shikimate accumulation assays showed that the Brazilian population was highly resistant to glyphosate, with an LD50 value (3,982 g glyphosate ha−1) more than twice the typical use rates and very little shikimate accumulation at 1 mM glyphosate concentrations in a leaf-disk assay. The Brazilian population was also resistant to sulfonylurea and imidazolinone acetolactate synthase (ALS) inhibitor herbicides. The resistance mechanisms in the Brazilian population were identified as increasedEPSPSgene copy number for glyphosate resistance (between 50- and 179-fold relativeEPSPSgene copy number increase) and two different alleles for target-site mutations in theALSgene (W574L and S653N). These results confirm the introduction of Palmer amaranth to Brazil using a genetic marker for species identification, as well as resistance to glyphosate and ALS inhibitors.

Target‐site mutation accumulation among ALS inhibitor‐resistant Palmer amaranth

“…The resistant Palmer amaranth accessions from Mississippi were cross‐resistant to IMIs, PTBs and SUs. The ALS‐resistant Palmer amaranth discovered recently in Brazil all carried the Trp574Leu mutation, whereas 42% of these plants also had the Ser653Asn mutation . The Palmer amaranth from Brazil was resistant to SUs, but was not tested for cross‐resistance to other ALS herbicide families.…”

“…The ALS-resistant Palmer amaranth discovered recently in Brazil all carried the Trp574Leu mutation, whereas 42% of these plants also had the Ser653Asn mutation. 46 The Palmer amaranth from Brazil was resistant to SUs, but was not tested for cross-resistance to other ALS herbicide families. In tall waterhemp, Trp574Leu endowed high levels of resistance to the ALS inhibitors tested including IMIs, SUs and TPs, whereas Ser653Asn caused resistance only to the IMIs.…”

Interspecific and intraspecific transference of metabolism‐based mesotrione resistance in dioecious weedy Amaranthus

“…Two KASP assays were used to determine whether individuals had S A. palmeri , R A. tuberculatus or hybrid (heterozygous) genotypes. The first SNP was located at base pair 678 in the ALS coding sequence and has been used previously as a RFLP marker (Tranel et al ., ) and as a KASP marker (Küpper et al ., ). The second marker is a 2‐bp polymorphism in the ITS of the ribosomal coding region (TBP‐ITS), designed to distinguish A. palmeri from eight other Amaranthus species (Table S4).…”

“…The protocol detailed in Küpper et al . () was used for the ALS marker. In brief, the ALS‐SNP assay used the following primers: A. tuberculatus forward primer, 5′‐GAAGGTGACCAAGTTCATGCTAAAAAGAAAGCTTCCTTAACAATTCTAGGG‐3′ (FAM Tag underlined); A. palmeri forward primer, 5′‐GAAGGTCGGAGTCAACGGATTAAAAAGAAAGCTTCCTTAACAATTCTAGGA‐3′ (HEX Tag underlined); universal reverse primer, 5′‐GTTGAGGTAACTCGATCCATTACTA AGC‐3′.…”

The power and potential of genomics in weed biology and management

“…Molecular diagnostics may also enable confirmation of species identity where novel invasions of weed species beyond their normal range are suspected. One example used species diagnostic KASP markers to confirm the recent invasion into Brazil of populations of A. palmeri , distinguishing this species from the complex of other weedy Amaranthus species previously documented in Brazil . Increasing access to genomic resources and sequence data for closely related weed species will continue to enable and inform these efforts.…”