Multiple Polymorphic Loci for Molecular Typing of Strains of Mycobacterium leprae

Abstract

The need for molecular tools for the differentiation of isolates of Mycobacterium leprae, the organism that causes leprosy, is urgent in view of the continuing high levels of new case detection, despite years of aggressive chemotherapy and the consequent reduction in the prevalence of leprosy. The slow onset of leprosy and the reliance on physical examination for detection of disease have restricted the epidemiological tracking necessary to understand and control transmission. Two genetic loci in several isolates of M. leprae have previously been demonstrated to contain variable-number tandem repeats (VNTRs). On the basis of these reports and the availability of the full genome sequence, multiple-locus VNTR analysis for strain typing has been undertaken. A panel of 11 short tandem repeat (STR) loci with repeat units of 1, 2, 3, 6, 12, 18, 21, and 27 bp from four clinical isolates of M. leprae propagated in armadillo hosts were screened by PCR. Fragment length polymorphisms were detected at 9 of the 11 loci by agarose gel electrophoresis. Sequencing of representative DNA products confirmed the presence of VNTRs between isolates. The application of nine new polymorphic STRs in conjunction with automated methods for electrophoresis and size determination allows greater discrimination between isolates of M. leprae and enhances the potential of this technique to track the transmission of leprosy.The World Health Organization and its partners created the Global Alliance for Leprosy Elimination in 1999 with the aim of achieving the elimination of leprosy by the end of the year 2005, a goal originally set for the year 2000 (http://www.who .int/inf-pr-1999/en/pr99-70.html). Leprosy is effectively controlled by a multidrug therapy (MDT) regimen composed of dapsone, rifampin, and clofazimine. However, continuing large numbers of new cases are being detected in areas of the world where the disease is highly endemic, despite the application of the MDT program since 1982 (36). In order to comprehend this rising incidence of leprosy, it is necessary to identify the natural reservoir of Mycobacterium leprae, the route of infection, and the mode of its transmission. It is commonly believed that the human is the host and reservoir of M. leprae and that successful MDT will eliminate leprosy. However, other modes of transmission involving nonhuman reservoirs, such as soil (6, 15), water (20), vegetation (16), animals (including armadillos and sooty mangabeys) (22, 33), and arthropods (fleas, ticks, mosquitoes, and flies), have been suggested, as reviewed by Blake et al. (3). The route of infection is also unknown, although the entry and the exit of the bacteria via the nasal passages have been proposed (9). Methods that specifically detect M. leprae DNA in nasal swabs are being developed with the aim of early detection in populations at the community and village levels and for the monitoring of leprosy transmission (13,23). Typing methods for distinguishing cases of relapse from new infections are also required. Molecular typing wi...

Deteccção do DNA de Mycobacterium leprae em secreção nasal

“…Conforme a literatura, a rota da infecção da hanseníase permanece ainda desconhecida, embora diversos estudos apontem a via nasal como a porta de entrada e saída da bactéria (17) .…”

Survey to identify Mycobacterium leprae-infected household contacts of patients from prevalent regions of leprosy in Colombia

“…DNA extraction was then carried out (Scollard et al 1998, Jadhav et al 2001. PCR testing was performed on each sample in duplicate using the primers and methodology previously described (Scollard et al 1998, Groathouse et al 2004). The 12-5 primer set for M. leprae which is specific for a single copy locus has a product length of 289 bp and the following sequences: 5´CTGGTCCACTTGCGGTACG3´ (forward), 5´GGAGAAGGAGGCCGAATACA3´ (reverse).…”

Diversity of Potential Short Tandem Repeats in Mycobacterium leprae and Application for Molecular Typing

“…In light of the transmission mode, human-to-human direct contact was first generally accepted (6, 16), with time as airborne (23), as vector-borne (14, 25) and as vehicle-borne (3, 12) routes from evidence that has been obtained. All the progress in leprosy epidemiology was helpful in understanding the chain of transmission, yet at the same time was overwhelming.In the past few years, studies focusing on leprosy transmission by molecular genotyping have shed new light on it (8,10,11,22,24,27,28). The most recent one was the report from Groathouse et al (8).…”