Molecular cloning of Bac7, a proline‐ and arginine‐rich antimicrobial peptide from bovine neutrophils

Abstract

Bac7 is a 7 kDa proline- and arginine-rich antimicrobial peptide which was purified from bovine neutrophils. We have used PCR to clone the cDNA of Bac7 precursor, a polypeptide of 21,569 Da. This cDNA is highly conserved in the 5' region, with respect to the corresponding region in the precursors of several other structurally unrelated myeloid antimicrobial peptides. Furthermore, a 148 nt non-coding region at the 3' end is 75% homologous to a corresponding region of the cDNA of the precursor of PR-39, a porcine antibacterial peptide which is also proline- and arginine-rich.

cDNA sequences of three sheep myeloid cathelicidins

“…1C) has a calculated mass of 21831 Da and pI of 11.7, and shows a Pro-and Arg-rich C-terminal domain of 60 residues following a 29 residue signal peptide and a 101 residue cathelin-like prosequence. This protein is 85% identical to the precursor of the bovine Bac7 [13], a 60 residue antimicrobial peptide characterized by a highly repetitive Pro-and Arg-rich sequence [37]. Comparison of the nucleotide sequences (not shown) shows 90% identity in the 5' pre-proregions (nt 1-390), 83% with a two gap insertion in the sequences corresponding to the antimicrobial domain (nt 391-570) and 93% in the 3' non-coding regions (nt 571-807).…”

“…Sequence comparison with the other mammalian antimicrobial peptides indicates that the highest level of identity (34%) is with the sequence of the porcine PMAP-36 [14]. Structure prediction analysis of SMAP-29 indicates that ATGGAGACCCAGATGGCCAGCCCCTCGCTGGGACGGT GTTCGCT GTGGCTCCTGCTGCTG [8,23], the sequence of Bac7 is from [13,37]. :, indicates identical residues; :, indicates similar residues.…”

“…It has recently been shown that a variety of myeloid antimicrobial peptides are located C-terminal to precursors characterized by a highly conserved pre-proregion [6][7][8][9][10][11][12][13][14][15][16][17][18][19]. The corresponding proforms are stored in the neutrophil granules [20,21].…”

“…The antimicrobial domains show significant diversity in size (12-100 residues), structure and spectrum of antimicrobial activity. Transcripts encoding proteins with these features have been identified in human [18,19,21], bovine [7][8][9]13] …”

Prophenin‐1, an exceptionally proline‐rich antimicrobial peptide from porcine leukocytes

“…Although these peptides show marked diversity in structure and antimicrobial spectrum, the precursors of many antibiotic peptides of porcine [2 6], bovine [7][8][9][10] and rabbit [11,12] origin contain a highly conserved preproregion that is homologous to cathelin, a putative cysteine-proteinase inhibitor originally isolated from pig leukocytes [13,14]. Several of these cathelin-associated peptides have been isolated and characterized, including porcine PR-39 [15] and protegrins PG-1, 2 and 3 [16]; bovine Bac 5 [17,18], indolicidin 9 [19] and cyclic dodecapeptide [20]; and rabbit p15 [12] and CAP 18 [11].…”