Molecular cloning and expression analysis of Fshr and Lhr in relation to Fshb and Lhb subunits during the period of temperature‐dependent sex determination in pejerrey Odontesthes bonariensis

Abstract

In this study, we cloned and characterized the follicle stimulating hormone receptor (Fshr) and luteinizing hormone receptor (Lhr) cDNAs of pejerrey Odontesthes bonariensis, a species with temperature-dependent sex determination (TSD), and analyzed their expression in relation to Fshb and Lhb subunits during gonadogenesis at temperatures producing only females (17 degrees C, FPT), both sexes (25 degrees C, MixPT), and only males (29 degrees C, MPT). The pejerrey Fshr cDNA had 3,069 bp for a mature protein of 694 amino acids (aa) and a signal peptide of 22 aa; the Lhr cDNA had 2,936 bp for a mature protein of 676 aa and a signal peptide of 25 aa. With the exception of Lhr in fish at the MPT, all genes showed significant increases and/or peaks of expression before histological differentiation of the gonads regardless of temperature. Larvae at the FPT had lower Fshb and Lhb but higher Lhr expression during the TSD period than those at the MPT; a clear pattern could not be ascertained for Fshr. At the MixPT, Fshb, Lhb, and Lhr mRNA increased in approximately half of the fish during TSD and sex differentiation and the sex ratio was 55.2% male. Based on the above results, it is suggested that animals with high Fshb and Lhb and low Lhr values represent putative males. These evidences, together with other studies, suggest that temperature may signal through the pituitary (differential expression of Fshb and Lhb) down to the gonads (differential expression of Lhr), probably affecting the regulation of steroidogenesis during the TSD process of pejerrey.

Transcriptome of Gonads From High Temperature Induced Sex Reversal During Sex Determination and Differentiation in Chinese Tongue Sole, Cynoglossus semilaevis

“…fshr is expressed in the theca and granulosa cells of the ovary, and sertoli cells in the testis. It belongs to the G-protein-coupled membrane receptors superfamily and regulate gametogenesis and production of sexual steroids in teleost gonads (Shinoda et al, 2010). The neuroactive ligand-receptor interaction pathway was also enriched in Gymnocypris przewalskii brain under high temperature, where neuroactive ligand-receptor genes exhibited sex- and tissue-specific expression patterns (Tian et al, 2019).…”

Pituitary–thyroid axis development during the larval–juvenile transition in the pejerrey Odontesthes bonariensis

“…The relative expression levels were normalized using β‐ actin as internal control (forward: 5′‐CTCTGGTCGTACCACTGGTATCG‐3′; reverse: 5′‐ GCAGAGCGTAGCCTTCATAGATG‐3′; amplification size: 83 bp). The β‐ actin gene has already been used to normalize samples for DNA quantity in preview studies done in O. bonariensis larvae reared at different temperatures (Shinoda et al, ; Fernandino et al, ; Tovar Bohórquez et al, ). The heads of six larvae were randomly sampled every week for total RNA isolation using TRIzol Reagent (http://www.lifetechnologies.com) following the manufacturer's instructions.…”

Differential expression analysis of genes involved in high-temperature induced sex differentiation in Nile tilapia

“…In the current study, we found that the expression of GTHα in the brain reduced under high temperature in the induction and recovery groups. LHβ is another critical mediator of sexual development and its expression is modulated by cAMP/PKA system (Horton and Halvorson, 2004;Shinoda et al, 2010). Pérez et al (2011) found that low temperature caused a higher expression of LHβ and FSHβ in European eel pituitary and higher E2 levels.…”