Molecular characterization of a genomic region in a Lactococcus bacteriophage that is involved in its sensitivity to the phage defense mechanism AbiA

Dinsmore, Polly K.; Klaenhammer, Todd R.

doi:10.1128/jb.179.9.2949-2957.1997

Cited by 51 publications

(48 citation statements)

References 57 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…AbiA protects against the major classes of lactococcal phages with a sensitivity profile that is similar but not identical to the set of AbiKsensitive phages (103,104). AbiA is similarly inferred to act at the stage of phage DNA replication, because DNA products do not accumulate in infected bacteria (104,105).…”

Section: Abia and Abi-p2mentioning

confidence: 99%

See 1 more Smart Citation

An Unexplored Diversity of Reverse Transcriptases in Bacteria

Zimmerly

2015

Microbiol Spectr

View full text Add to dashboard Cite

Reverse transcriptases (RTs) are usually thought of as eukaryotic enzymes, but they are also present in bacteria and likely originated in bacteria and migrated to eukaryotes. Only three types of bacterial retroelements have been substantially characterized: group II introns, diversity-generating retroelements, and retrons. Recent work, however, has identified a myriad of uncharacterized RTs and RT-related sequences in bacterial genomes, which exhibit great sequence diversity and a range of domain structures. Apart from group II introns, none of these putative RTs show evidence of active retromobility. Instead, available information suggests that they are involved in useful processes, sometimes related to phages or phage resistance. This article reviews our knowledge of both characterized and uncharacterized RTs in bacteria. The range of their sequences and genomic contexts promises the discovery of new biochemical reactions and biological phenomena.

show abstract

Section: Abia and Abi-p2mentioning

confidence: 99%

“…A second group of resistance mutations mapped to an intergenic inverted repeat sequence lying 500 bp upstream of phage ORF245 (105), for which there is no reported parallel for AbiK.…”

Section: Abia and Abi-p2mentioning

confidence: 99%

An Unexplored Diversity of Reverse Transcriptases in Bacteria

Zimmerly

2015

Microbiol Spectr

View full text Add to dashboard Cite

show abstract

“…A 6-ml aliquot was removed from each culture, pelleted, and quick frozen for RNA extraction. Total cellular RNA was isolated using TRIzol reagent (GIBCO-BRL, Gaithersburg, MD) as described previously (10). PCR products for making probes were amplified using the following primer pairs: abiA, GATCTCTAGATTTTGGTAGCTAAAATGGTA* and ACCCAT CTATTAACTTTCCTTCTG; integrase, GATCGGATCCAATTTTCTGTCCA CTTTT* and ATAATCAGAGCGGTCTAAGC; transposase, CATTGTTGGC GGAATGAGGATTAT and ACCTCTACCAAACAGGTAAA*; ORF Y, GG TTCAGAATAAGGCTATTCTTG* and GTAATATCAGAATCTCCTGTAG; ORF X, GATCGGATCCCACCTTAAGCTATTTATCAA and GATCTCTAG ATTCCTCAAACGCCTAACAAA*; and ORF 25, GATCGGATCCATATCC TCGCTGTCATTT* and TCGGGATTAACCTAGATCAC.…”

Section: Vol 189 2007 Abortive Phage Resistance Abiz Induces Prematmentioning

confidence: 99%

Abortive Phage Resistance Mechanism AbiZ Speeds the Lysis Clock To Cause Premature Lysis of Phage-Infected Lactococcus lactis

Durmaz¹,

Klaenhammer

2007

J Bacteriol

View full text Add to dashboard Cite

The conjugative plasmid pTR2030 has been used extensively to confer phage resistance in commercial Lactococcus starter cultures. The plasmid harbors a 16-kb region, flanked by insertion sequence (IS) elements, that encodes the restriction/modification system LlaI and carries an abortive infection gene, abiA. The AbiA system inhibits both prolate and small isometric phages by interfering with the early stages of phage DNA replication. However, abiA alone does not account for the full abortive activity reported for pTR2030. In this study, a 7.5-kb region positioned within the IS elements and downstream of abiA was sequenced to reveal seven additional open reading frames (ORFs). A single ORF, designated abiZ, was found to be responsible for a significant reduction in plaque size and an efficiency of plaquing (EOP) of 10 ؊6 , without affecting phage adsorption. AbiZ causes phage 31-infected Lactococcus lactis NCK203 to lyse 15 min early, reducing the burst size of 31 100-fold. Thirteen of 14 phages of the P335 group were sensitive to AbiZ, through reduction in either plaque size, EOP, or both. The predicted AbiZ protein contains two predicted transmembrane helices but shows no significant DNA homologies. When the phage 31 lysin and holin genes were cloned into the nisin-inducible shuttle vector pMSP3545, nisin induction of holin and lysin caused partial lysis of NCK203. In the presence of AbiZ, lysis occurred 30 min earlier. In holin-induced cells, membrane permeability as measured using propidium iodide was greater in the presence of AbiZ. These results suggest that AbiZ may interact cooperatively with holin to cause premature lysis.The susceptibility of starter cultures to bacteriophage infection remains a problem in the cheese industry, especially with increasing reliance on defined starters and the high turnover in factories (8). Analysis of phage resistance mechanisms in starters has led to the identification of four categories of natural bacteriophage resistance in lactococci: (i) interference with phage adsorption, (ii) interference with phage DNA injection, (iii) DNA restriction/modification (R/M), and (iv) abortive infection. Numerous plasmids encoding one or more of these systems have been isolated from commercial starter strains (2,7,8). Abortive infection defenses (Abi) cause a disruption of phage development postinfection, resulting in a decrease in the number of infective particles released and death of the infected cells (7,8). Nonsterile milk fermentations provide an evolutionary proving ground, in which lactic acid bacteria are exposed to constant challenge from bacteriophages. Phage defense mechanisms are often encoded on plasmids, many of which are conjugative, facilitating their transfer within starter culture populations.There are three established groups of phages infecting L. lactis: groups c2 and 936 are composed of lytic phages which are highly homologous within the groups, while the P335 group contains both lytic and lysogenic members and is characterized by mosaic genomes showing evidence ...

show abstract

“…In order to understand how some phages escape Abi, spontaneous variants of sensitive phages, able to overcome AbiA, AbiC, AbiD1, AbiF, or AbiK, have been selected. Among these, P335 phages have been shown to acquire resistance to Abi's either by recombination with host chromosomal sequences (8,31) or by spontaneous mutation (18). By contrast, virulent phages of the 936 or c6A group, having no prophage counterpart on the host chromosome, have been shown to evolve resistance to Abi's by mutation only (4,20).…”

mentioning

confidence: 99%

The Lactococcal Abortive Phage Infection System AbiP Prevents both Phage DNA Replication and Temporal Transcription Switch

et al. 2004

View full text Add to dashboard Cite

We describe here a new lactococcal abortive phage infection system, designated AbiP. AbiP is effective against some lactococcal phages of one prevalent group, 936, but not against phages from the other two groups (c6A and P335 Dairy fermentations using lactococci are highly susceptible to bacteriophage attacks. Therefore, special attention has been given to lactococcal phage defense mechanisms and in particular to abortive phage infection systems (Abi). These systems arrest phage multiplication and cause premature cell death upon infection. This decreases the number of progeny particles produced and limits their spread to other cells. As a consequence, the cell population survives (reviewed in references 32 and 39).Twenty-two lactococcal Abi genes, designated abiA to abiT, have been described (7, 9, 43; for a review, see reference 20). Three of these (abiD, abiD1, and abiF) code for proteins sharing 28 to 46% identity throughout the protein sequence. Similarly, AbiA and AbiK share 23% identity. Putative products of the other abi genes show no homology. Lactococcal phages fall into three prevalent groups of DNA homology (29). Two of these groups, designated 936 and c6A, are composed of virulent phages responsible for industrial fermentation failures, and the third, designated P335, is composed mostly of temperate phages. Phages from one of these groups share essentially no DNA homology with members of the other groups (13).

show abstract

Molecular characterization of a genomic region in a Lactococcus bacteriophage that is involved in its sensitivity to the phage defense mechanism AbiA

Abstract: A spontaneous mutant of the lactococcal phage 31 that is insensitive to the phage defense mechanism AbiA was characterized in an effort to identify the phage factor(s) involved in sensitivity of 31 to AbiA. A point mutation was localized in the genome of the AbiA-insensitive phage (

Cited by 51 publications

References 57 publications

An Unexplored Diversity of Reverse Transcriptases in Bacteria

An Unexplored Diversity of Reverse Transcriptases in Bacteria

Abortive Phage Resistance Mechanism AbiZ Speeds the Lysis Clock To Cause Premature Lysis of Phage-Infected Lactococcus lactis

The Lactococcal Abortive Phage Infection System AbiP Prevents both Phage DNA Replication and Temporal Transcription Switch

Contact Info

Product

Resources

About