Method for Isolation of PCR-Ready Genomic DNA from Zebrafish Tissues

Meeker, Nathan D.; Hutchinson, Sarah A.; Ho, Linh; Trede, Nikolaus S.

doi:10.2144/000112619

Cited by 428 publications

(361 citation statements)

References 3 publications

(3 reference statements)

Supporting

Mentioning

343

Contrasting

Order By: Relevance

“…Genomic DNA was isolated from caudal fin tissue using a hot sodium hydroxide methodology. 58 After PCR amplification (pde6c primers: Forward: 5 0 -ttggcctctggaatactggctctc-3 0 ; reverse: 5 0 -gtttgaccagaacccggaag-3 0 ), the 157 bp products were digested with BsaX1 enzyme to determine genotype.…”

Section: Discussionmentioning

confidence: 99%

Rip3 knockdown rescues photoreceptor cell death in blind pde6c zebrafish

et al. 2014

View full text Add to dashboard Cite

Achromatopsia is a progressive autosomal recessive retinal disease characterized by early loss of cone photoreceptors and later rod photoreceptor loss. In most cases, mutations have been identified in CNGA3, CNGB3, GNAT2, PDE6C or PDE6H genes. Owing to this genetic heterogeneity, mutation-independent therapeutic schemes aimed at preventing cone cell death are very attractive treatment strategies. In pde6c w59 mutant zebrafish, cone photoreceptors expressed high levels of receptor-interacting protein kinase 1 (RIP1) and receptor-interacting protein kinase 3 (RIP3) kinases, key regulators of necroptotic cell death. In contrast, rod photoreceptor cells were alternatively immunopositive for caspase-3 indicating activation of caspase-dependent apoptosis in these cells. Morpholino gene knockdown of rip3 in pde6c w59 embryos rescued the dying cone photoreceptors by inhibiting the formation of reactive oxygen species and by inhibiting second-order neuron remodelling in the inner retina. In rip3 morphant larvae, visual function was restored in the cones by upregulation of the rod phosphodiesterase genes (pde6a and pde6b), compensating for the lack of cone pde6c suggesting that cones are able to adapt to their local environment. Furthermore, we demonstrated through pharmacological inhibition of RIP1 and RIP3 activity that cone cell death was also delayed.Collectively, these results demonstrate that the underlying mechanism of cone cell death in the pde6c w59 mutant retina is through necroptosis, whereas rod photoreceptor bystander death occurs through a caspase-dependent mechanism. This suggests that targeting the RIP kinase signalling pathway could be an effective therapeutic intervention in retinal degeneration patients. As bystander cell death is an important feature of many retinal diseases, combinatorial approaches targeting different cell death pathways may evolve as an important general principle in treatment.

show abstract

Section: Discussionmentioning

confidence: 99%

Rip3 knockdown rescues photoreceptor cell death in blind pde6c zebrafish

et al. 2014

View full text Add to dashboard Cite

show abstract

“…As EGFP expression was not visible in A. burtoni at 14 dpf, the day of GnRH1 onset (44), 75 of these injected fish were cohoused and their offspring were screened by PCR for germ-line transmission of the GnRH1:EGFP transgene using PCR as follows. When F 1 fry were large enough to collect fin clips (∼5 wk postfertilization), a small tissue sample was obtained from the tailfin of each fry, and DNA was extracted in a 15 min incubation in 50 mM NaOH at 95°C and neutralization with 1 M Tris (pH 8.0) (45). F 1 carriers of the GnRH1:EGFP transgene were identified through PCR with the primers GnRH1genoFwd (5′-GCA GCA GAC TTC ACA AAG GAC AG-3′) and EGFPgenoRev (5′-AGC TTG CCG TAG GTG GCA TC-3′).…”

Section: Methodsmentioning

confidence: 99%

Electrical synapses connect a network of gonadotropin releasing hormone neurons in a cichlid fish

Juntti

et al. 2015

Proc. Natl. Acad. Sci. U.S.A.

View full text Add to dashboard Cite

Initiating and regulating vertebrate reproduction requires pulsatile release of gonadotropin-releasing hormone (GnRH1) from the hypothalamus. Coordinated GnRH1 release, not simply elevated absolute levels, effects the release of pituitary gonadotropins that drive steroid production in the gonads. However, the mechanisms underlying synchronization of GnRH1 neurons are unknown. Control of synchronicity by gap junctions between GnRH1 neurons has been proposed but not previously found. We recorded simultaneously from pairs of transgenically labeled GnRH1 neurons in adult male Astatotilapia burtoni cichlid fish. We report that GnRH1 neurons are strongly and uniformly interconnected by electrical synapses that can drive spiking in connected cells and can be reversibly blocked by meclofenamic acid. Our results suggest that electrical synapses could promote coordinated spike firing in a cellular assemblage of GnRH1 neurons to produce the pulsatile output necessary for activation of the pituitary and reproduction.transgenic | GnRH | gap junction | cichlid | electrophysiology

show abstract

“…As part of a larger study on the phylo geography of IndoPacific reef fishes (for examples see Craig et al 2007, Gaither et al 2010 (Meeker et al 2007). A 797 base pair ( bp) segment of the mito chondrial (mtDNA) cytochrome b (cyt b) gene was amplified using a heavystrand (5′GTGACTTGAAAAACCACCGTTG3′ [Song et al 1998]) and lightstrand primer (5′AATAGGAAGTATCATTCGGGT TTGATG3′ [Taberlet et al 1992]).…”

Section: Methodsmentioning

confidence: 99%

Acanthurus nigrosGünther, a Valid Species of Surgeonfish, Distinct from the HawaiianA. nigrorisValenciennes

Randall

DiBattista

Wilcox³

2011

Pacific Science

View full text Add to dashboard Cite

Abstract:The Blueline Surgeonfish, Acanthurus nigroris Valenciennes, formerly considered as wideranging in the central and western Pacific, is restricted to the Hawaiian Islands. Acanthurus nigros Günther, type locality Vanuatu, is available for the sister species from the Pitcairn Islands west to the Great Barrier Reef and Caroline Islands. Although these two species are very similar in color, there are finray and gillraker differences, and the genetic difference (i.e., 4.12% mtDNA cytochrome b sequence divergence) alone warrants species recognition.

show abstract

Method for Isolation of PCR-Ready Genomic DNA from Zebrafish Tissues

Cited by 428 publications

References 3 publications

Rip3 knockdown rescues photoreceptor cell death in blind pde6c zebrafish

Rip3 knockdown rescues photoreceptor cell death in blind pde6c zebrafish

Electrical synapses connect a network of gonadotropin releasing hormone neurons in a cichlid fish

Acanthurus nigrosGünther, a Valid Species of Surgeonfish, Distinct from the HawaiianA. nigrorisValenciennes

Contact Info

Product

Resources

About