Mechanically Activated Calcium Channel PIEZO1 Modulates Radiation-Induced Epithelial-Mesenchymal Transition by Forming a Positive Feedback With TGF-β1

Abstract

TGF-β-centered epithelial-mesenchymal transition (EMT) is a key process involved in radiation-induced pulmonary injury (RIPI) and pulmonary fibrosis. PIEZO1, a mechanosensitive calcium channel, is expressed in myeloid cell and has been found to play an important role in bleomycin-induced pulmonary fibrosis. Whether PIEZO1 is related with radiation-induced EMT remains elusive. Herein, we found that PIEZO1 is functional in rat primary type II epithelial cells and RLE-6TN cells. After irradiation, PIEZO1 expression was increased in rat lung alveolar type II epithelial cells and RLE-6TN cell line, which was accompanied with EMT changes evidenced by increased TGF-β1, N-cadherin, Vimentin, Fibronectin, and α-SMA expression and decreased E-cadherin expression. Addition of exogenous TGF-β1 further enhanced these phenomena in vitro. Knockdown of PIEZO1 partly reverses radiation-induced EMT in vitro. Mechanistically, we found that activation of PIEZO1 could upregulate TGF-β1 expression and promote EMT through Ca2+/HIF-1α signaling. Knockdown of HIF-1α partly reverses enhanced TGF-β1 expression caused by radiation. Meanwhile, the expression of PIEZO1 was up-regulated after TGF-β1 co-culture, and the mechanism could be traced to the inhibition of transcription factor C/EBPβ expression by TGF-β1. Irradiation also caused a decrease in C/EBPβ expression in RLE-6TN cells. Dual luciferase reporter assay and chromatin immunoprecipitation assay (ChIP) confirmed that C/EBPβ represses PIEZO1 expression by binding to the PIEZO1 promoter. Furthermore, overexpression of C/EBPβ by using the synonymous mutation to C/EBPβ siRNA could reverse siRNA-induced upregulation of PIEZO1. In summary, our research suggests a critical role of PIEZO1 signaling in radiation-induced EMT by forming positive feedback with TGF-β1.

Piezo1 Channels as Force Sensors in Mechanical Force-Related Chronic Inflammation

“…Electricity plays a vital role in wound healing by activating Piezo1 channels and Ca 2+ influx ( 154 ). Knockdown of Piezo1 partially reversed radiation-induced in vitro epithelial-mesenchymal transition and played a therapeutic role in bleomycin-induced pulmonary fibrosis in rats ( 155 ). It also suggests the potential role of Piezo1 in tumor radiotherapy.…”

Enriched environment ameliorates fear memory impairments induced by sleep deprivation via inhibiting PIEZO1/calpain/autophagy signaling pathway in the basal forebrain

“…mRNA was reverse transcribed to cDNA using PrimeScript™ RT reagent kit with gDNA Eraser (Takara) as a template, and then amplified on a PCR instrument (Bio‐Rad), and finally the raw results were obtained from Bio‐Rad CFX Manager software and then analyzed using the method. The primer sequences used were as follows: PIEZO1, Forward: 5′‐CGGACAGTGAGGAGGAAGAGGAG‐3′ and Reverse: 5′‐CCTGTTCACGACGACGCTGCCTTAG‐3′; p62, Forward: 5′‐GGATGGGGACTTGGTTGC‐3′ and Reverse: 5′‐TCACAGATCACATTGGGGTGC‐3′; GAPDH, Forward: 5′‐CAGTGCCAGCCTCGTCTCAT‐3′ and Reverse: 5′‐AGGGGCCATCCACAGTCTTC‐3′ 31 …”

“…The primer sequences used were as follows: PIEZO1, Forward: 5′-CGGAC AGT GAG GAG GAA GAGGAG-3′ and Reverse: 5′-CCTGT TCA CGA CGA CGC TGC CTTAG-3′; p62, Forward: 5′-GGATG GGG ACT TGG TTGC-3′ and Reverse: 5′-TCACA GAT CAC ATT GGG GTGC-3′; GAPDH, Forward: 5′-CAGTG CCA GCC TCG TCTCAT-3′ and Reverse: 5′-AGGGG CCA TCC ACA GTCTTC-3′. 31…”

Mechanical regulation of signal transduction in angiogenesis

“…Genetic deletion and pharmacological inhibition of Piezo1 reduce endothelial sprouting and lumen formation. Downstream of the calcium signaling from Piezo1 and TRPV4 there is an increase in HIF-1α expression, as a result, VEGF expression is increased ( Liu et al, 1995 ; Huang et al, 2021 ). Notably, HIF expression decreases after shear stress treatment, indicating that HIF activation induces stretch- but not shear-mediated angiogenesis ( Milkiewicz et al, 2007 ).…”