Markerless Gene Deletion by Floxed Cassette Allelic Exchange Mutagenesis in <em>Chlamydia trachomatis</em>

Abstract

Chlamydia trachomatis is an obligate intracellular pathogen that has been historically difficult to genetically manipulate. Definitive progress in elucidating the mechanisms that C. trachomatis use to create and maintain a privileged intracellular niche has been limited due to a lack of genetic tools. Fortunately, there have recently been several new advances in genetic manipulation techniques. Among these is the development of fluorescence-reported allelic exchange mutagenesis (FRAEM). This method allows targeted gene deletion coupled with insertion of a selection cassette encoding antibiotic resistance and green fluorescent protein (GFP). Reliance on this strategy can be complicated when targeting genes within polycistronic operons due to the potential of polar effects on downstream genes. Floxed cassette allelic exchange mutagenesis (FLAEM), the protocol for which is described here, was developed to alleviate cassette-induced polar effects. FLAEM utilizes Cre-loxP genome editing to remove the selection cassette after targeted deletion by allelic exchange. The resulting strains contain markerless gene deletions of one or more coding sequences. This technique facilitates direct assessment of gene function and expands the repertoire of tools for genetic manipulation in C. trachomatis.

c-Myc plays a key role in IFN-γ-induced persistence of Chlamydia trachomatis

“…Since Ctr have an intact Trp synthase operon the effects of c-Myc on the rescue of IFN-γ-induced persistence could be indirect, for example, by the provision of precursors of the Trp synthase. We therefore generated a trp BA mutant in Ctr by Fluorescence-reported Allelic Exchange Mutagenesis (FRAEM) ( Keb and Fields, 2020 ). This mutant lacked expression of TrpA or TrpB ( Figure 7A ) and was resistant to rescue from IFN-γ-induced persistence by generating Trp from indole ( Figure 7B ), in line with the phenotype of Trp synthase negative Ctr ( Caldwell et al, 2003 ).…”

“…The C. trachomatis serovar L 2 /434/Bu trp BA mutants were generated by Fluorescence-reported Allelic Exchange Mutagenesis (FRAEM) as previously described ( Keb and Fields, 2020 ; Mueller et al, 2016 ). Briefly, the up- and downstream fragments of trp A were amplified with primers trpA_us_fwd/trpA_us_rev (trpA up fwd: GCAGGTACCGGTCGACGAGAGCGGTTGAGTGCTATTTC ; trpA up rev: AGTAGGAATGGTCGAAAATTCCTCTGTTTCTGCGGATG ) and trpA_ds_fwd/trpA_ds_rev (trpA down fwd: TACGAAGTTATGACCTTTATGAATATGAATATGAAGCCCA ; trpA down rev: CGGGGTCTGACGCCCGCTCTTGTTGGTTTCGGCAT ) from Ctr genomic DNA.…”

“…The resulting vector was then transformed into Ctr using CaCl 2 . McCoy cells were infected and transformants were selected by treatment with spectinomycin ( Keb and Fields, 2020 ). Additionally, AHT selection was required for the expression of the plasmid replication factor pgp6.…”

Expression and structure of the Chlamydia trachomatis DksA ortholog

“…2017 , Keb et al . 2018 , Keb and Fields 2020 ) or CRISPR interference (Ouellette 2018 , Ouellette et al . 2021 ) in case dksA Ct is essential to C. trachomatis intracellular replication and/or developmental transitions.…”

The inclusion membrane protein IncS is critical for initiation of the Chlamydia intracellular developmental cycle

“…3-kb fragments downstream and upstream of incS (PCR A, right arm and PCR B, left arm, respectively) were amplified from C. trachomatis L2 genomic DNA via PCR using primers pSUmC3Dwn0402 5 2.1 and 3Dwn0402pSumC 3 2.1 and pSUmC3Up0402 5 and 3Up0402pSUmC 3, respectively. PCR A and PCR B were sequentially cloned into the SbfI and SalI sites of pSUmC-4.0, respectively, so that each arm immediately flanked the aadA-gfp cassette [46].…”