Iron toxicity and other chemical soil constraints to rice in highland swamps of Burundi

Detection of Chromosomal Regions Affecting Iron Concentration in Rice Shoots Subjected to Excess Ferrous Iron Using Chromosomal Segment Substitution Lines betweenJaponicaandIndica

“…However, excess iron is toxic to plant tissues because it generates hydroxyl radicals that damage membrane lipids, proteins and DNA (Becana et al, 1998). For rice (Oryza sativa L.), excess ferrous iron in soil causes brown spots on leaves, known as 'bronzing', and retards the growth of shoots and roots, reducing grain yields (Tanaka et al, 1966b;Tadano, 1976;Genon et al, 1994). Decreased rice yields due to ferrous iron toxicity were reported to range from 15 to 100% (Becker and Asch, 2005).…”

“…However, in waterlogged and acidic pH conditions, ferric iron is reduced to the soluble ferrous form (Fe 2+ ) that is readily absorbed by plant roots (Sahrawat, 2004). Toxicity of excess ferrous iron is a major constraint for rice production, particularly on acidic lowland soils in Asia, South America and West Africa (Ponnamperuma et al, 1955;Genon et al, 1994;Audebert and Sahrawat, 2000). The optimum concentration of ferrous iron for rice growth was predicted to be between 0.0018 and 0.18 mM using hydroponic culture solutions (Ishizuka et al, 1961).…”

Role of ferritin in the rice tolerance to iron overload

“…The synthesized first strand cDNA was diluted five times and 2 μL were used for PCR analysis with specific primers for ferritin. Primers used for ferritin amplification (forward 5'CCAAAGGGAAGGAGGTGCTC 3', reverse 5'GAATTCGCTCTCAACGAAG 3') were designed to amplify a region conserved in both ferritin isoforms previously described (Gross et al, 2003). The PCR conditions used were 95°C for 30 s, 60°C for 30 s and 72°C for 30 s in a 50 μL volume.…”

“…When cultivated in waterlogged conditions, which increase Fe solubility, rice plants can face Fe overload (Sahrawat, 2004). Total grain weight reduction of 50% has been reported on rice plants with leaf Fe concentrations higher than 250µg g -1 dry weight (Genon et al, 1994). Rice genotypes vary in their resistance to Fe excess, and the mechanisms underlying resistance are not well understood.…”

“…Two ferritin genes have been identified in the rice genome by Gross et al (2003). Ferritin gene regulation by Fe has been documented in rice only for the African species Oryza glaberrima Steud (Majerus et al, 2007).…”