Intein-mediated Cyclization of Bacterial Acyl Carrier Protein Stabilizes Its Folded Conformation but Does Not Abolish Function

Abstract

Bacterial acyl carrier protein (ACP) is essential for the synthesis of fatty acids and serves as the major acyl donor for the formation of phospholipids and other lipid products. Acyl-ACP encloses attached fatty acyl groups in a hydrophobic pocket within a four-helix bundle, but must at least partially unfold to present the acyl chain to the active sites of its multiple enzyme partners. To further examine the constraints of ACP structure and function, we have constructed a cyclic version of Vibrio harveyi ACP, using split-intein technology to covalently join its closely apposed N and C termini. Cyclization stabilized ACP in a folded helical conformation as indicated by gel electrophoresis, circular dichroism, fluorescence, and mass spectrometry. Molecular dynamics simulations also indicated overall decreased polypeptide chain mobility in cyclic ACP, although no major conformational rearrangements over a 10-ns period were noted. In vivo complementation assays revealed that cyclic ACP can functionally replace the linear wild-type protein and support growth of an Escherichia coli ACP-null mutant strain. Cyclization of a folding-deficient ACP mutant (F50A) both restored its ability to adopt a folded conformation and enhanced complementation of growth. Our results thus suggest that ACP must be able to adopt a folded conformation for biological activity, and that its function does not require complete unfolding of the protein. Bacterial acyl carrier protein (ACP)2 is a small (typically 70 -80 residue) protein required for the synthesis and transfer of fatty acyl chains in the production of phospholipids and other specialized products, including lipid A, lipoic acid, acylhomoserine lactones, and hemolysin (reviewed in Ref. 1). Over two dozen nuclear magnetic resonance (NMR) and x-ray crystal structures have revealed a conserved "ACP fold" consisting of a four-helix bundle (1). Fatty acids covalently attached to the phosphopantetheine prosthetic group at the N-terminal end of helix II are enclosed within the hydrophobic interior of this bundle, interacting predominantly with residues on helices II-IV (2-5). Further computational (6, 7), crystallographic (8, 9), and mutagenic (10 -13) analyses have implicated the acidic central helix II as a "recognition helix" for interaction with most of the ACP enzyme partners. Subtle conformational alterations in this region likely also contribute to discrimination by ACPdependent enzymes among the various acyl-ACP derivatives (4,14).The acidic nature of ACP (pI ϳ 4) contributes to a highly dynamic and flexible structure in solution, and some ACPs exhibit features characteristic of natively unfolded proteins (1). For example, Vibrio harveyi ACP is largely unfolded at neutral pH, but its helical conformation can be stabilized by charge neutralization (i.e. at low pH or by residue replacements) (13), by binding of divalent cations to helix II (10), or by interaction with partner enzymes (15). Molecular dynamic simulations (16) and NMR experiments (17, 18) have indicated greatest mobili...

Evolution of acyl-ACP thioesterases and β-ketoacyl-ACP synthases revealed by protein–protein interactions

“…Since ACP is essential, this strain also harbors acpp on an arabinose-inducible plasmid (De Lay and Cronan 2007). CY1877 was transformed with IPTG-inducible plasmids (proteins were cloned into pGEX-5X3 using BamH1 and Xho1) harboring Cr-cACP or FAS ACP from Vibrio harveyi (VhACP) (Volkmann et al 2010). Transformants were selected on LB-agar plates supplemented with 50 μg/ml spectinomycin, 100 μg/ml ampicillin and 0.2% w/v arabinose after overnight incubation at 37 °C.…”

“…Sterile filter discs were added to each plate, 1 pmol of IPTG spotted, and incubated at 25 °C and 37 °C overnight. In parallel, the assay was performed in liquid culture, as previously described (Volkmann et al 2010). …”

The Conserved Modular Elements of the Acyl Carrier Proteins of Lipid Synthesis Are Only Partially Interchangeable

“…3 H]Alanine Labeling-Strain CY2211 is derived from strain CY1871, which was briefly described previously (15). Strain CY1871 (Table 2) is a derivative of the ⌬acpP::cat strain NRD62 (10) in which the lambda prophage has been removed from the host chromosome and the ampicillin resistance of the AcpP encoding plasmid has been replaced by spectinomycin resistance.…”

Intein lacking conserved C‐terminal motif G retains controllable N‐cleavage activity

“…Plasmids pMI N H and pMI N were constructed by replacing the 639‐bp Xho I‐ Hind III fragment in pMI N C [24] with a 478‐bp Xho I‐ Hind III fragment produced by PCR [ Ssp GyrB S11 I N with C‐terminal His 6 tag (MI N H protein), amplified with primers 5′‐GGGCTCGAGGGCGGTTGTTTTTCTGGAGATAC‐3′ and 5′‐GGGAAGCTTCAATGGTGGTGATGGTGATGGCTTGC‐3′] or a 461‐bp Xho I/ Hind III‐digested PCR product [ Ssp GyrB S11 I N without additional C‐terminal amino acids (MI N protein), amplified with primers 5′‐GGGCTCGAGGGCGGTTGTTTTTCTGGAGATAC‐3′ and 5′‐GGGAAGCTTTCATGATGCCAAAGCAAAATTGTGG‐3′). To construct a fusion protein consisting of red fluorescent protein, I N and the chitin‐binding domain (RI N C), the I N C coding sequence was PCR amplified from pMI N C using a pair of primers (5′‐GGGAAGCTTGGCGGTTGTTTTTCTGGAGATAC‐3′ and 5′‐GGCTGCAGTCATTATTGAAGCTGCCACAAGGC‐3′), digested with Hind III and Pst I, and cloned into similarly digested vector pT [46], yielding the intermediate plasmid pTI N C. The coding sequence of monomeric red fluorescent protein [47] was PCR amplified from genomic DNA obtained from a yeast strain carrying red fluorescent protein‐tagged Spc42 [48] using a pair of primers (5′‐GGGAGCTCATGGCCTCCTCCGAGGACGTCATC‐3′ and 5′‐GGGAAGCTTGGCGCCGGTGGAGTGGCGGCCCTC‐3′), digested with Sac I and Hind III, and cloned into similarly digested pTI N C to give pTRI N C. For substitution of the natural Ssp GyrB −1 residue, the MI N C open reading frame was cloned into the pAR3 vector [49] under the control of an arabinose‐inducible promoter. The sequence encoding for the Gly–1 residue was changed to the other amino acid codons by inverse PCR using the universal reverse primer 5′‐GAGCGTACCCCTTCCCTCGATCCCGAGGTTGTTGTTATTG‐3′ and individual forward primers based on the oligonucleotide sequence 5′‐GAGGGCXXXTGTTTTTCTGGAGATACATTAGTCG‐3′, where XXX represents a given amino acid triplet.…”