Importance of Saprotrophic Freshwater Fungi for Pollen Degradation

Abstract

Fungi and bacteria are the major organic matter (OM) decomposers in aquatic ecosystems. While bacteria are regarded as primary mineralizers in the pelagic zone of lakes and oceans, fungi dominate OM decomposition in streams and wetlands. Recent findings indicate that fungal communities are also active in lakes, but little is known about their diversity and interactions with bacteria. Therefore, the decomposer niche overlap of saprotrophic fungi and bacteria was studied on pollen (as a seasonally recurring source of fine particulate OM) by performing microcosm experiments with three different lake types. Special emphasis was placed on analysis of fungal community composition and diversity. We hypothesized that (I) pollen select for small saprotrophic fungi and at the same time for typical particle-associated bacteria; (II) fungal communities form specific free-living and attached sub-communities in each lake type; (III) the ratio between fungi or bacteria on pollen is controlled by the lake's chemistry. Bacteria-to-fungi ratios were determined by quantitative PCR (qPCR), and bacterial and fungal diversity were studied by clone libraries and denaturing gradient gel electrophoresis (DGGE) fingerprints. A protease assay was used to identify functional differences between treatments. For generalization, systematic differences in bacteria-to-fungi ratios were analyzed with a dataset from the nearby Baltic Sea rivers. High abundances of Chytridiomycota as well as occurrences of Cryptomycota and yeast-like fungi confirm the decomposer niche overlap of saprotrophic fungi and bacteria on pollen. As hypothesized, microbial communities consistently differed between the lake types and exhibited functional differences. Bacteria-to-fungi ratios correlated well with parameters such as organic carbon and pH. The importance of dissolved organic carbon and nitrogen for bacteria-to-fungi ratios was supported by the Baltic Sea river dataset. Our findings highlight the fact that carbon-to-nitrogen ratios may also control fungal contributions to OM decomposition in aquatic ecosystems.

Long‐read DNA metabarcoding of ribosomal RNA in the analysis of fungi from aquatic environments

“…Approximately 4,500 bp of the eukaryotic rRNA operon (Figure ), including SSU, ITS1, 5.8S, ITS2 and partial LSU (D1‐D8 region, Wurzbacher, Rösel, Rychła, & Grossart, ) regions, was PCR‐amplified using the primers NS1_short (5′‐ CAGTAGTCATATGCTTGTC‐3′) and RCA95m with a 5′ mismatch spacer (5′‐ACCTATGTTTTAATTAGACAGTCAG‐3′) (Wurzbacher et al, ). Symmetric (reverse complement) 16‐mer barcodes were added to the 5′ ends of primers (Supporting Information Table S1) following the PacBio manufacturer's guidelines on multiplexing SMRT sequencing.…”

High habitat-specificity in fungal communities in oligo-mesotrophic, temperate Lake Stechlin (North-East Germany)

“…Both D1 and D2 regions were formerly used as molecular markers for fungi, especially yeast (Kurtzman and Robnett 1997) and perform almost as well as the commonly used ITS region in discriminating fungal groups (Schoch et al 2012). The LSU is an established phylogenetic marker for Chytridiomycota ) and, unlike the ITS region, it can be used to delimit distant aquatic fungal lineages (Lefèvre et al 2012;Wurzbacher et al 2014). The small ribosomal subunit (SSU) is also well established for early diverging lineages (e.g., Jobard et al 2012;Ishii et al 2015); however, it is less suitable for fungal groups within Dikarya Tedersoo et al 2015) and would fail to generate meaningful OTUs for a broad spectrum of simultaneously occurring fungal phyla, such as in our biofilm habitat.…”

“…Lake Stechlin is part of the global lake ecological observatory network (GLEON) and has been monitored since 1959 (Casper 1985). Of the many publications from Lake Stechlin, few have examined the fungi (Casper 1965;Luo et al 2011;Wurzbacher et al 2014). This study thus represents the first attempt to characterize Lake Stechlin's mycobiota.…”

“…However, in an unbiased water sample (i.e. not fractionated by filtration or enriched by a plankton net), they were replaced as dominant group by the order Spizellomycetales, which are common saproptrophs in soil and may underline to the importance of saprotrophic chytrids in aquatic environments (Wurzbacher et al 2014). …”

Carbon and nutrients of indigestible pollen are transferred to zooplankton by chytrid fungi

“…Those grains are more probably to be used in the water column. Pollen grains persisting within the water column have been shown to be rapidly colonized by heterotrophic bacteria and fungi in lakes (Rösel et al., ; Wurzbacher, Rösel, Rychła, & Grossart, ). Pollen grains are protected by an extracellular wall (exine), making them highly resistant to microbial degradation and zooplankton digestion.…”