Identification of potential drug targets for tuberous sclerosis complex by synthetic screens combining CRISPR-based knockouts with RNAi

Abstract

The tuberous sclerosis complex (TSC) family of tumor suppressors, TSC1 and TSC2, function together in an evolutionarily conserved protein complex that is a point of convergence for major cell signaling pathways that regulate mTOR complex 1 (mTORC1). Mutation or aberrant inhibition of the TSC complex is common in various human tumor syndromes and cancers. The discovery of novel therapeutic strategies to selectively target cells with functional loss of this complex is therefore of clinical relevance to patients with nonmalignant TSC and those with sporadic cancers. We developed a CRISPR-based method to generate homogeneous mutant Drosophila cell lines. By combining TSC1 or TSC2 mutant cell lines with RNAi screens against all kinases and phosphatases, we identified synthetic interactions with TSC1 and TSC2. Individual knockdown of three candidate genes (mRNA-cap, Pitslre, and CycT; orthologs of RNGTT, CDK11, and CCNT1 in humans) reduced the population growth rate of Drosophila cells lacking either TSC1 or TSC2 but not that of wild-type cells. Moreover, individual knockdown of these three genes had similar growth-inhibiting effects in mammalian TSC2-deficient cell lines, including human tumor-derived cells, illustrating the power of this cross-species screening strategy to identify potential drug targets.

Cyclin-Dependent Kinase 11 (CDK11) Is Required for Ovarian Cancer Cell Growth In Vitro and In Vivo, and Its Inhibition Causes Apoptosis and Sensitizes Cells to Paclitaxel

“…Knockdown of CDK11 by CRISPR-based RNAi technology also showed growth-inhibiting effects in mammalian tuberous sclerosis complex 2 (TSC2)-deficient cell lines, including in human tumor-derived acute myeloid leukemia (AML) cells (20). …”

A Mechanism Coupling Systemic Energy Sensing to Adipokine Secretion

“…The gRNA sequence for GRASP65-A was designed using “DRSC find CRISPR (version 2)” (Housden et al, 2015). The GRASP65-A construct was generated by cloning annealed oligonucleotides encoding the gRNA sequence (TGTCCTGTACCTTGAGTACG) between the BbsI cut sites of the pl100 vector (Ren et al, 2013).…”

Mapping signaling pathway cross-talk in Drosophila cells

“…S2R+ (39), S2 (40), Kc167 (41), and STAT92E mutant (28) Drosophila cell lines were cultured using standard procedures. STAT92E mutant cells contain a frameshift deletion within the STAT92E gene and were previously shown to result in complete loss of detectible transcription factor activity (28). Cell induction.…”