Identification of plant materials containing ephedrine alkaloids based on DNA barcoding and TaqMan real-time PCR assay

Abstract

An intentional or inadvertent mixing of plant materials containing ephedrine alkaloids, especially Ephedra, is illegal. In order to better detect plant materials containing ephedrine alkaloids in export and smuggling, DNA barcoding combined with a TaqMan real-time PCR-based assay were used in this study. We collected 201 samples from 18 species belonging to four genera distributed in three families to amplify two barcoding markers, internal transcribed spacer 2 (ITS2) and psbA-trnH. 175 ITS2 sequences and 136 psbA-trnH sequences were obtained. Alignments and the neighbor-joining tree indicated that ITS2 showed a better discrimination of species than psbA-trnH. In addition, based on the sequence comparison of the ITS2 region from 18 species, three sets of primer/probes were designed using the real-time PCR assay platform. A sensitivity test showed the above primer/probe sets were specific and sensitive (as little as 0.0050 ng/μL target DNA) to identify species containing ephedrine alkaloids. Hence, the combination of novel DNA barcoding and the TaqMan real-time PCR-based technique are promising tools for the identification of plant materials containing ephedrine alkaloids. It is beneficial to standardize market circulation and detection of plant materials containing ephedrine alkaloids.

Interpol Review of Drug Analysis 2019-2022

“…2019 study of the Chloroplast genomes of the three Ephedra species encoded 118 genes, including 73 protein-coding genes, 37 tRNA genes and 8 ribosomal RNA genes [ 309 ]; field surveys of Ephedra plants in the Zarayshan Mountains of Tajikistanto to determine total ephedrine and pseudoephedrine content [ 310 ]; characterization of the complete chloroplast genome of Ephedra sinica Stapf (Ephedraceae) [ 311 ]; chloroplast genome of Ephedra sinica (Ephedraceae) [ 312 ]; LC-MS/MS method for the determination of ephedrine in various food supplements [ 313 ]; capillary electrochromatography separation of ephedrine and pseudoephedrine isomers [ 314 ]; 2020 review of characterization methods to isolate compounds of Ephedra species characterized by MS-based techniques LC-MS, LC-ESI-MS, HPLC-PDA-ESI/MS, LC-DAD-ESI/MSn, LC/Orbitrap MS, etc. [ 315 ]; characterization of difference fractions of ephedra extracts and ephedrine alkaloids [ 316 ]; 2021 LC/MS quantitative analysis of ephedrine and pseudoephedrine in Ephedrae herba [ 317 ]; phytochemical fingerprint profile of the bioactive compounds from Ephedra fragilis including optimization of extraction and chemical characterization using RP-HPLC [ 318 ]; HPTLC supplemented with injection port derivatization GC-MS for analysis of ephedra herbal extracts [ 319 ]; DART-TOF-MS applied to whole plant bio-imaging of Ephedrae Herba for localization of major Ephedra Alkaloids [ 320 ]; identification of plant materials containing ephedrine alkaloids using DNA barcoding and TaqMan real-time PCR assay [ 321 ]; 2022 comparison of volatile oils and primary metabolites of raw and honey-processed ephedrae herba by GC-MS and chemometrics [ 322 ]; qualitative profiling of Ephedra alata monjauzeana using RP-HPLC-ESI-QTOF-MS [ 323 ]; relationship between ephedrine alkaloid profile in Ephedra gerardiana and soil characteristics [ 324 ]; characterization of the phyto-chemical profile of Ephedra alata subsp. alenda seeds extract using HPLC-ESI-QTOF-MS [ 325 ]; HPLC method for the simultaneous determination of five alkaloids (norephedrine, norpseudoephedrine, ephedrine, pseudoephedrine, and methylephedrine) in Ephedrae Herba [ 326 ]; collection of 224 ITS2 sequences representing 59 taxa within Ephedra and a 23-base pairs genus-level nucleotide signature (GTCCGGTCCGCCTCGGCGGTGCG) was developed for the identification of the whole genus signature and for the identification of Ephedra-containing products [ 327 ].…”

Comparative Plastome Analyses of Ephedra przewalskii and E. monosperma (Ephedraceae)

“…Also, the diarylheptanoid has anti-tumor activity [11,12]. Direct ionization mass spectrometry or ITS2 barcodes are commonly used to identify Ephedra species [13,14]. Studies of Ephedra have concentrated on transcriptome data mining, the medicinal value of its chemical compounds, and the classification of morphological characteristics [11][12][13][14].…”

“…Direct ionization mass spectrometry or ITS2 barcodes are commonly used to identify Ephedra species [13,14]. Studies of Ephedra have concentrated on transcriptome data mining, the medicinal value of its chemical compounds, and the classification of morphological characteristics [11][12][13][14]. Despite numerous previous studies, it is difficult to distinguish Ephedra species based on morphological features [15].…”