Identification of mRNA for epidermal growth factor and transforming growth factor-α present in low copy number in human endometrium and decidua using reverse transcriptase-polymerase chain reaction

Abstract

The presence of mRNA for epidermal growth factor (EGF) and transforming growth factor-alpha (TGF alpha) was demonstrated in small fragments of human endometrium and decidua by use of the technique of reverse transcriptase-polymerase chain reaction with nested oligonucleotide primers. The presence of mRNA encoding EGF and TGF alpha has not been shown in human endometrium previously. Other studies using conventional techniques, such as Northern blot or in-situ hybridization, showed the presence in low copy number of EGF but not TGF alpha in murine endometrium. Messenger RNA for EGF was not present in peripheral leukocytes or platelets, suggesting an endometrial source for the message. Messenger RNA for TGF alpha was found in these blood components, thus preventing confirmation of the source of TGF alpha mRNA.

Metformin Down-regulates Endometrial Carcinoma Cell Secretion of IGF-1 and Expression of IGF-1R

“…So, till now serum IGF-1 can not be the serum predictor for endometrial carcinoma. But IGF-1 can be produced by the uterus endometrial stromal cells, regulating cell proliferation and differentiation in autocrine and paracrine manner (Haining et al, 1991). Moreover, endometrial carcinoma cells can synthesize and secrete IGF-I and IGF-II, which can integrate with their IGF-1R membrane receptor and cause continuous proliferation of the tumor cells (Pavelie et al, 2007;Sarkissyan et al, 2014).…”

In Vivo Assessment of the Regulation of Transforming Growth Factor Alpha, Epidermal Growth Factor (EGF), and EGF Receptor in the Human Endometrium by Medroxyprogesterone Acetate

“…Immunoreactive TGFα has been detected in the luminal surface epithelium of endometrial samples during all phases of menstrual cycle, but a diminished expression has been observed during the midsecretory phase (7). A possible cyclic variation in the expression of EGF and EGF-R in the endometrium is controversial, being observed (8-10) or not (4,11,12) in different studies.…”

“…4 To whom correspondence should be addressed at Department of Physiology, Federal University (UFRGS), Rua Sarmento Leite, 500, 90050-170 Porto Alegre, Rio Grande do Sul, Brazil; e-mail: spritzer@vortex.ufrgs.br.…”

“…TGFα and EGF are produced by the human endometrium across the menstrual cycle and by the decidua henceforth, and both act via paracrine and autocrine mechanisms to regulate endometrial growth (1,2,(4)(5)(6). Immunoreactive TGFα has been detected in the luminal surface epithelium of endometrial samples during all phases of menstrual cycle, but a diminished expression has been observed during the midsecretory phase (7).…”

Somatostatin and the phosphorylation of the epidermal growth factor/transforming growth factor alpha (TGFalpha) receptor in LNCaP cells: interactions with a locally produced TGFalpha

“…The oligonucleotide primers used in the experiments were designed according to known regions of human TGFα (Heining et al 1991). To ensure maximal specificity and sensitivity, nested oligonucleotide primers were used as follows: external: TGTTCGCTCTGGGTA TTGTG forward (nucleotides 63-82 of the human cDNA) and reverse: GGACCGACGACAGGAATAGTATG (reverse complement of nucleotides 364-383); internal: forward ACGTCCCCGCTGAGTGCAG (nucleotides 113-132) and reverse: GGTAGTGGCGGAACCACCAC (nucleotides 320-349).…”