Human T-Cell Leukemia Virus Type 1 Tax Protein Down-Regulates Pre-T-Cell Receptor Alpha Gene Transcription in Human Immature Thymocytes

Abstract

The human pre-T-cell receptor alpha (TCR␣; pT␣) gene encodes a polypeptide which associates with the TCR␤ chain and CD3 molecules to form the pre-TCR complex. The surface expression of the pre-TCR is pT␣ dependent, and signaling through this complex triggers an early ␣␤ T-cell developmental checkpoint inside the thymus, known as ␤-selection. E2A transcription factors, which are involved at multiple stages of T-cell development, regulate the transcription of the pT␣ gene. Here we show that the regulatory protein Tax of the human T-cell leukemia virus type 1 (HTLV-1) efficiently suppresses the E47-mediated activation of the pT␣ promoter. Furthermore, we report that in Tax lentivirally transduced human MOLT-4 T cells, which constitutively express the pT␣ gene, the amount of pT␣ transcripts decreases. Such a decrease is not observed in MOLT-4 cells transduced by a vector encoding the Tax mutant K88A, which is unable to interact with p300. These data underline that Tax inhibits pT␣ transcription by recruiting this coactivator. Finally, we show that the expression of Tax in human immature thymocytes results in a decrease of pT␣ gene transcription but does not modify the level of E47 transcripts. These observations indicate that Tax, by silencing E proteins, down-regulates pT␣ gene transcription during early thymocyte development. They further provide evidence that Tax can interfere with an important checkpoint during T-cell differentiation in the thymus.

Cross Talk between Expression of the Human T-Cell Leukemia Virus Type 1 Tax Transactivator and the Oncogenic bHLH Transcription Factor TAL1

“…1D). In agreement with a previous study (45), the amount of pT␣ mRNA was strongly reduced under similar conditions (Fig. 1E).…”

“…The HTLV1-LTR-luc was kindly provided by A. Rabson (27). pJFE-Tax WT, M22, M47, and K88A were previously described (45). Plasmid pSUPER-TAL1 was generated by annealing the oligonucleotides 5Ј-GATCCCCGAAGCTCAGCAAGAATGAGCTC TTCCTCCTCATTCTTGCTGAGCTTCTTTTT-3Ј and 5Ј-AGCTAAAAAG AAGCTCAGCAAGAATGAGGAGGAAGAGCTCATTCTTGCTGAGCT TCGGG-3Ј and inserting the resulting DNA fragment between the BglII and HindIII restriction sites of pSUPER (6).…”

“…cDNA from Tax-expressing immature thymocytes was obtained and analyzed as described previously (45). Briefly, total thymocytes were extracted from thymus fragments removed during cardiac surgery of patients aged 1 week to 2 years.…”

“…Wencker et al recently reported that Tax suppresses the E47-mediated activation of the pT␣ promoter in immature thymocytes by the same mechanism (45). Considering the effect of Tax on bHLH factors, we further wondered whether it could act on TAL1, which is a key factor in T-cell leukemogenesis.…”

The Use of Artificial Neural Networks in Analysis Cationic Trypsinogen Gene and Hepatitis B Surface Antigen

“…That is to say the immune response of HBV will be reduced if mutations occur in the TCR [11][12][13][14][15][16][17][18][19] . Some studies have indicated that the priority expression and employment of TCR were related with the specific immune reaction of chronic hepatitis B [20][21][22][23][24][25][26][27] . In our study of the object, we discovered that the growth rates of leukomonocyte were difference among the patients who bring A121T, C139S mutation, normal controls and common pancreatitis patients and the growth rate of leukomonocyte of the patients who bring A121T and C139S mutation was comparatively low and that the CD4⁄CD8 proportionality was degraded.…”