HT‐29 and Caco‐2 Reporter Cell Lines for Functional Studies of Nuclear Factor Kappa B Activation

Abstract

The NF-κB is a transcription factor which plays a key role in regulating biological processes. In response to signals, NF-κB activation occurs via phosphorylation of its inhibitor, which dissociates from the NF-κB dimer allowing the translocation to the nucleus, inducing gene expression. NF-κB activation has direct screening applications for drug discovery for several therapeutic indications. Thus, pathway-specific reporter cell systems appear as useful tools to screen and unravel the mode of action of probiotics and natural and synthetic compounds. Here, we describe the generation, characterization, and validation of human epithelial reporter cell lines for functional studies of NF-κB activation by different pro- and anti-inflammatory agents. Caco-2 and HT-29 cells were transfected with a pNF-κB-hrGFP plasmid which contains the GFP gene under the control of NF-κB binding elements. Three proinflammatory cytokines (TNF-α, IL-1β, and LPS) were able to activate the reporter systems in a dose-response manner, which corresponds to the activation of the NF-κB signaling pathway. Finally, the reporter cell lines were validated using lactic acid bacteria and a natural compound. We have established robust Caco-2-NF-κB-hrGFP and HT-29-NF-κB-hrGFP reporter cell lines which represent a valuable tool for primary screening and identification of bacterial strains and compounds with a potential therapeutic interest.

Individual Members of the Microbiota Disproportionately Modulate Host Innate Immune Responses

“…Our model demonstrates the feasibility of predicting the function of a microbiota based on its composition when specific properties of the individual species are known. Our modeling approach could be expanded to more complex systems, such as the mouse or human gastrointestinal tract, where the mono-association data in our model could be replaced with data based on other individual traits, such as pro- or anti-inflammatory properties measured in a cell based assay (Mastropietro et al, 2015). It will be interesting to see whether other functions of complex microbial communities, such as carbohydrate metabolism in mice (Sonnenburg et al, 2006) and nutrient acquisition in flies (Newell and Douglas, 2014) are consistent with additive contributions from species with different per capita effects or whether a quantitative description of these systems will require evoking non-additive interactions.…”

Targeting the pregnane X receptor using microbial metabolite mimicry

“…NF‐κB reporter assays were performed using LS180 cells. Briefly, LS180 cells (passages 8 and 13) (Mastropietro et al , ) were transiently transfected using FuGENE HD Transfection Reagent with a reporter plasmid pNL3.2‐NF‐κB‐RE[NlucP/NF‐κB‐RE/hygro] from Promega (Hercules, CA, USA), with or without co‐transfection of the wt‐PXR expression vector. Following 16 h of stabilization, the transfected cells were treated with a vehicle (DMSO, 0.1% v/v), rifampicin (RIF, 10 μM), or the tested compounds FKK5 or FKK6 in a concentration range from 0.1 to 25 μM for 24 h. For the last 4 h of the treatment, a combination of tested compounds or rifampicin with tumor necrosis factor α (TNF‐α, 5 ng/ml) was applied.…”

Targeting the Pregnane X Receptor Using Microbial Metabolite Mimicry

“…were used since NF-κB activity can be influenced by cell passage) 54 GAPDH CTCTGCTCCTCCTGTTCGAC ACGACCAAATCCGTTGACTC 60…”