Histone Deacetylase-1 (HDAC1) Is a Molecular Switch between Neuronal Survival and Death

Abstract

Background:The role of HDAC1 in the regulation of neuronal survival is unresolved. Results: In cooperation with HDRP, HDAC1 promotes neuronal survival, but when it interacts with HDAC3, HDAC1 promotes neuronal death. Conclusion: HDAC1 can protect neurons or promote neuronal death depending on whether it interacts with HDRP or HDAC3. Significance: Our results provide insight into the role of HDAC1 in the regulation of neuronal survival.

Niemann-Pick C disease and mobilization of lysosomal cholesterol by cyclodextrin

“…One of the most promising is inhibition of histone deacetylases (HDACs). HDACs appear to play important roles in neuronal survival ( 158,159 ). HDAC inhibitors have already been approved for clinical use in humans for treatment of certain cancers.…”

Histone Deacetylase 3 Is Necessary for Proper Brain Development

“…Generation of Hdac3 Ϫ/Ϫ cKO Mice-Hdac3 Ϫ/Ϫ cKO mice were generated as described previously (10). Briefly, for CNSspecific knockdown, mice homozygous for loxP sites in the HDAC3 locus (Hdac3…”

“…Genotyping-Genotyping of Nes-Cre/HDAC3, Thy1-Cre/ HDAC3, and CaMKII-Cre/HDAC3 cKO mice was performed as described previously (10,12). Briefly, DNA was extracted from mouse toe clips for Thy1-Cre/HDAC3 and CaMKII-Cre/ HDAC3 or tail tissue for Nes-Cre/HDAC3 mice using the REDExtract-N-Amp tissue PCR kit from Sigma-Aldrich (St. Louis, MO), and the DNA obtained was used in PCRs to determine the genotype: HDAC3, GCTTGGTAGCCAGCCAGCT-TAG (forward) and CATGTGACCCCAGACATGACTGG (reverse); Cre, CCCGCAGAACCTGAAGATGTT (forward) and CGGCTATACGTAACAGGGTG (reverse); and Gdf, AAGCCCTCAGTCAGTTGTGC (forward) and AAAAC-CATGAAAGGAGTGGG (reverse).…”

Human neuronal cells: epigenetic aspects

“…Previously, the HDAC-related protein (HDRP), a truncated form of HDAC9, was shown to recruit HDAC1 and deacetylate H3 at c-Jun promoter regions, which is dependent upon HDAC1 deacetylase activity (111) . Bardai et al (110) showed that HDAC1 and HDRP associate via HDAC1 N -terminal tails and the neurotoxic HDAC1-HDAC3 interaction is reduced when HDRP expression is elevated, suggesting that HDAC1 is sequestered by HDRP. Taken together, HDAC1 performs as a molecular switch in regulating neuronal fate.…”

“…Taken together, this study effectively identified HDAC3 as a potent neurotoxic deacetylase and therefore becomes an attractive target to downregulate in an effort to increase neuronal viability during neurodegeneration (109) . In a subsequent study, the authors showed that HDAC1 contributes to neurodegeneration and is highly neurotoxic, as it complexes with HDAC3 in mediating neuronal death (110) . Previously, the HDAC-related protein (HDRP), a truncated form of HDAC9, was shown to recruit HDAC1 and deacetylate H3 at c-Jun promoter regions, which is dependent upon HDAC1 deacetylase activity (111) .…”