High yield preparation of genomic DNA from
            <i>Streptomyces</i>

Nikodinovic, Jasmina; Barrow, Kevin D.; Chuck, Jo-Anne

doi:10.2144/03355bm05

Cited by 86 publications

(62 citation statements)

References 20 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Genomic DNA was isolated by the method of Nikodinovic et al. . Gene for 16S rRNA was amplified from genomic DNA using universal bacterial primers 27F (5′‐AGAGTTTGATCCTGGCTCAG‐3′) and 1492R (5′‐GGTTACCTTGTTACGACTT‐3′).…”

Section: Methodsmentioning

confidence: 99%

Biocatalytic potential of Streptomyces spp. isolates from rhizosphere of plants and mycorrhizosphere of fungi

Spasic

Mandic

Radivojević

et al. 2018

Biotech and App Biochem

View full text Add to dashboard Cite

Biocatalytic potential of Streptomyces strains isolated from the rhizosphere of plants and from mycorrhizosphere of fungi has been investigated. A total of 118 Streptomyces isolates were selected and functionally screened for 10 different biotechnologically important enzymatic activities: hydrolase (cellulase, cutinase, gelatinase, lipase, protease, polyhydroxyalkanoate (PHA) depolymerase), phenol oxidase and peroxidase (laccase, tyrosinase, and lignin peroxidase), and aminotransferase. Out of 118 tested Streptomyces spp., 90% showed at least one enzymatic activity. The most abundant were enzymes involved in the biomass degradation, as the production of cutinase, cellulase, and lignin peroxidase were detected in 31%, 40%, and 48% of the isolates, respectively. The improved specific activities of lipase (isolates BV315 and BV100) and tyrosinase (isolates BV87 and BV88) were shown in comparison with the industrially relevant activities of Pseudomonas strains. Plant rhizosphere soils were more prolific source of Streptomyces strains with biocatalytic potential in comparison with mycorrhizosphere soils. Overall, 284 enzyme activities among 118 Streptomyces isolates have been detected. This is the first comprehensive screening of Streptomyces isolates from rhizosphere and mycorrhizosphere soils for novel biocatalysts, showing that specific environmental habitats, such as rhizosphere soils, are "treasure troves" of Streptomyces with biocatalytic potential.

show abstract

Section: Methodsmentioning

confidence: 99%

Biocatalytic potential of Streptomyces spp. isolates from rhizosphere of plants and mycorrhizosphere of fungi

Spasic

Mandic

Radivojević

et al. 2018

Biotech and App Biochem

View full text Add to dashboard Cite

show abstract

“…Bacterial strains were cultivated in 30 ml ISP2 medium at 37°C, 48 h, 150 rev min −1 and microbial cells were harvested by centrifugation at 14 000 g for 5 min at 4°C, lysed and the genomic DNA was purified according to the protocol of Nicodinovic et al (). The DNAs were air‐dried and dissolved in TE buffer (10 mmol l −1 Tris‐HCl, pH 8·2 and 10 mmol l −1 ethylene diaminetetra acetic acid; EDTA) and stored at −20°C until use.…”

Section: Methodsmentioning

confidence: 99%

Unique secondary metabolites of a Streptomyces strain isolated from extreme salty wetland show antioxidant and antibacterial activities

Riahi

Hosni²,

Raïes

et al. 2019

J Appl Microbiol

View full text Add to dashboard Cite

Aims To identify and assess the biological activities of the crude extract of a Streptomyces isolate from a salty wetland, an extreme environment likely to induce secondary metabolism of micro‐organisms. Methods and Results The crude extract from the isolate Streptomyces lanatus strain AR2 displayed antibacterial activity against Gram‐positive bacteria (MICs ranging from 5 to 50 μg ml−1) and antioxidant activity as revealed in DPPH (2,2‐diphenyl‐1‐picrylhydrazyl) assay (IC50 of 0·74 mg ml−1), ferric reducing antioxidant power (IC50 of 1·12 mg ml−1) and metal‐chelating power (IC50 of 1·84 mg ml−1) assays. Accordingly, the extract attenuated the H2O2‐induced oxidative stress in the eukaryotic cell model Saccharomyces cerevisiae, assessed by flow cytometry. The profiling of secondary metabolites by HPLC‐PDA‐ESI‐MS/MS revealed the presence of 17 compounds, some of which reported in Streptomyces for the first time to the best of our knowledge: genistein‐7‐O‐glucuronide, naringenin‐7‐O‐rutinoside and resveratrol. Conclusions Streptomyces lanatus AR2 produced unique polyketides and phenolic compounds with noticeable bioactivities, allowing adaptation to the extreme environment. Significance and Impact of the Study Sabkhat Seijoumi salty wetland represents a potential niche for Streptomyces yielding useful natural products for biotechnological, pharmaceutical and medical applications.

show abstract

“…orientalis KCTC 9412 T was grown in tryptic soy broth containing wheat starch (0.1%) at 30°C. Cells were disrupted by lysozyme plus achromopeptidase (4), and chromosomal DNA was purified by a genomic DNA isolation kit (Promega). Genome sequencing was carried out using an Illumina HiSeq 2000 system.…”

Section: Genome Announcementmentioning

confidence: 99%

Genome Sequence of the Vancomycin-Producing Amycolatopsis orientalis subsp. orientalis Strain KCTC 9412 ^T

et al. 2013

View full text Add to dashboard Cite

show abstract

High yield preparation of genomic DNA from Streptomyces

Abstract: tamyl hydrolase and folylpolyglutamate synthetase activities predict polyglutamylation of methotrexate in acute leukemias. Oncol. Res.

Cited by 86 publications

References 20 publications

Biocatalytic potential of Streptomyces spp. isolates from rhizosphere of plants and mycorrhizosphere of fungi

Biocatalytic potential of Streptomyces spp. isolates from rhizosphere of plants and mycorrhizosphere of fungi

Unique secondary metabolites of a Streptomyces strain isolated from extreme salty wetland show antioxidant and antibacterial activities

Genome Sequence of the Vancomycin-Producing Amycolatopsis orientalis subsp. orientalis Strain KCTC 9412 ^T

Contact Info

Product

Resources

About

High yield preparation of genomic DNA from Streptomyces

Abstract: tamyl hydrolase and folylpolyglutamate synthetase activities predict polyglutamylation of methotrexate in acute leukemias. Oncol. Res.

Cited by 86 publications

References 20 publications

Biocatalytic potential of Streptomyces spp. isolates from rhizosphere of plants and mycorrhizosphere of fungi

Biocatalytic potential of Streptomyces spp. isolates from rhizosphere of plants and mycorrhizosphere of fungi

Unique secondary metabolites of a Streptomyces strain isolated from extreme salty wetland show antioxidant and antibacterial activities

Genome Sequence of the Vancomycin-Producing Amycolatopsis orientalis subsp. orientalis Strain KCTC 9412 T

Contact Info

Product

Resources

About

Genome Sequence of the Vancomycin-Producing Amycolatopsis orientalis subsp. orientalis Strain KCTC 9412 ^T