hERG 1a LQT2 C-terminus truncation mutants display hERG 1b-dependent dominant negative mechanisms

Puckerin, Akil; Aromolaran, Kelly A.; Chang, Donald D.; Zukin, R. Suzanne; Colecraft, Henry M.; Boutjdir, Mohamed; Aromolaran, Ademuyiwa S.

doi:10.1016/j.hrthm.2016.01.012

Cited by 23 publications

(29 citation statements)

References 22 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The BBS-hERG-YFP constructs were engineered on the previously described hERG1a-YFP template ( Puckerin et al, 2016 ), which utilized overlap extension PCR to fuse enhanced yellow fluorescent protein (EYFP) in frame to the C-terminus of hERG1a. A 13-residue bungarotoxin-binding site (BBS; TGGCGGTACTACGAGAGCAGCCTGGAGCCCTACCCCGAC) ( Sekine-Aizawa and Huganir, 2004 ; Yang et al, 2010 ) was then introduced between residues T436/E437 in the extracellular S1–S2 loop of hERG using the Quik-Change Lightning Site-Directed Mutagenesis Kit (Stratagene) according to the manufacturer’s instructions.…”

Section: Methodsmentioning

confidence: 99%

Development of a High-Throughput Flow Cytometry Assay to Monitor Defective Trafficking and Rescue of Long QT2 Mutant hERG Channels

2018

Self Cite

View full text Add to dashboard Cite

Long QT Syndrome (LQTS) is an acquired or inherited disorder characterized by prolonged QT interval, exertion-triggered arrhythmias, and sudden cardiac death. One of the most prevalent hereditary LQTS subtypes, LQT2, results from loss-of-function mutations in the hERG channel, which conducts IKr, the rapid component of the delayed rectifier K+ current, critical for cardiac repolarization. The majority of LQT2 mutations result in Class 2 deficits characterized by impaired maturation and trafficking of hERG channels. Here, we have developed a high-throughput flow cytometric assay to analyze the surface and total expression of wild-type (WT) and mutant hERG channels with single-cell resolution. To test our method, we focused on 16 LQT2 mutations in the hERG Per-Arnt-Sim (PAS) domain that were previously studied via a widely used biochemical approach that compares levels of 135-kDa immature and 155-kDa fully glycosylated hERG protein to infer surface expression. We confirmed that LQT2 mutants expressed in HEK293 cells displayed a decreased surface density compared to WT hERG, and were differentially rescued by low temperature. However, we also uncovered some notable differences from the findings obtained via the biochemical approach. In particular, three mutations (N33T, R56Q, and A57P) with apparent WT-like hERG glycosylation patterns displayed up to 50% decreased surface expression. Furthermore, despite WT-like levels of complex glycosylation, these mutants have impaired forward trafficking, and exhibit varying half-lives at the cell surface. The results highlight utility of the surface labeling/flow cytometry approach to quantitatively assess trafficking deficiencies associated with LQT2 mutations, to discern underlying mechanisms, and to report on interventions that rescue deficits in hERG surface expression.

show abstract

Section: Methodsmentioning

confidence: 99%

Development of a High-Throughput Flow Cytometry Assay to Monitor Defective Trafficking and Rescue of Long QT2 Mutant hERG Channels

2018

Self Cite

View full text Add to dashboard Cite

show abstract

“…C‐terminal truncation of K v 2.1 channel has been shown to impact surface expression, voltage‐dependent gating function, and phosphorylation‐dependent modulation of the channel (Jensen et al, ; Mohapatra et al, ). Truncated K v 2.1 channel could thus impact trafficking of tetrameric K v 2.1 channel to the cell membrane leading to functional consequences on channel properties, as demonstrated in few other channelopathies (Aizawa et al, ; Duarri et al, ; Mezghrani et al, ; Puckerin et al, ). Other truncating variants were also in the last exon of the gene but located upstream the C‐terminal domain, either in extracellular loops or in the pore helix, with no obvious phenotypic difference compared to missense variants.…”

Section: Genotype‐phenotype Correlationmentioning

confidence: 99%

Expanding the genetic and phenotypic relevance of KCNB1 variants in developmental and epileptic encephalopathies: 27 new patients and overview of the literature

Bar

Barcia

Jennesson³

et al. 2019

Human Mutation

View full text Add to dashboard Cite

Developmental and epileptic encephalopathies (DEE) refer to a heterogeneous group of devastating neurodevelopmental disorders. Variants in KCNB1 have been recently reported in patients with early‐onset DEE. KCNB1 encodes the α subunit of the delayed rectifier voltage‐dependent potassium channel Kv2.1. We review the 37 previously reported patients carrying 29 distinct KCNB1 variants and significantly expand the mutational spectrum describing 18 novel variants from 27 unreported patients. Most variants occur de novo and mainly consist of missense variants located on the voltage sensor and the pore domain of Kv2.1. We also report the first inherited variant (p.Arg583*). KCNB1‐related encephalopathies encompass a wide spectrum of neurodevelopmental disorders with predominant language difficulties and behavioral impairment. Eighty‐five percent of patients developed epilepsies with variable syndromes and prognosis. Truncating variants in the C‐terminal domain are associated with a less‐severe epileptic phenotype. Overall, this report provides an up‐to‐date review of the mutational and clinical spectrum of KCNB1, strengthening its place as a causal gene in DEEs and emphasizing the need for further functional studies to unravel the underlying mechanisms.

show abstract

“…Prolongation in corrected QT (QT c ) interval such as LQTS (QT c intervals > 440–470 ms in men and > 460–480 ms in women) (Schwartz et al, 2009), or an abbreviated QT c or short QT syndrome (SQT; <360 ms in men and <370 ms in women) (Brugada et al, 2004) predispose to arrhythmic events. The pathophysiology of congenital or acquired LQTS is generally defined by a decrease in repolarizing currents (Aromolaran et al, 2014; Puckerin et al, 2016) or an increase in depolarizing currents (Wehrens et al, 2003; Fredj et al, 2006; Cheng et al, 2011; Hsiao et al, 2013). In obese patients cardiomyopathies are manifested as longer P-wave, and increased QT c dispersion (Seyfeli et al, 2006; Nielsen et al, 2013b).…”

Section: Ionic Mechanisms Of Cardiomyopathies Of Obesitymentioning

confidence: 99%

“…In the human heart, I Kr exists as a tetramer composed of the human ether-á-go-go-related gene (or hERG), 1a and 1b pore-forming or α subunits (Puckerin et al, 2016). There have also been reports that I Kr is generated by a combination of hERG and the MinK-related peptide 1 protein (Abbott et al, 1999) suggesting that the precise molecular composition of cardiac I Kr is still a matter of debate.…”

Section: Delayed Rectifier K Currents (Ikur Ikr and Iks) And Obesitymentioning

confidence: 99%

“…Pathological decreases in I Ks are generally mediated by congenital mutations in KCNQ1 (LQT1) or KCNE1 (LQT5), with loss-of-function mutations in KCNQ1 accounting for ~30–45% of all inherited LQT cases (Tester et al, 2005). Gating defects, impaired assembly and reduced trafficking are some of the molecular mechanisms that have been proposed to underlie decreased cardiac I Kr and I Ks density commonly associated with LQTS (Aromolaran et al, 2014; Puckerin et al, 2016). It will also be important to assess whether and how these molecular processes are altered in obesity.…”

Section: Delayed Rectifier K Currents (Ikur Ikr and Iks) And Obesitymentioning

confidence: 99%

See 1 more Smart Citation

Cardiac Ion Channel Regulation in Obesity and the Metabolic Syndrome: Relevance to Long QT Syndrome and Atrial Fibrillation

Aromolaran

Boutjdir

2017

Front. Physiol.

Self Cite

View full text Add to dashboard Cite

Obesity and its associated metabolic dysregulation leading to metabolic syndrome is an epidemic that poses a significant public health problem. More than one-third of the world population is overweight or obese leading to enhanced risk of cardiovascular disease (CVD) incidence and mortality. Obesity predisposes to atrial fibrillation, ventricular, and supraventricular arrhythmias; conditions that are underlain by dysfunction in electrical activity of the heart. To date, current therapeutic options for cardiomyopathy of obesity are limited, suggesting that there is considerable room for development of therapeutic interventions with novel mechanisms of action that will help normalize rhythm in obese patients. Emerging candidates for modulation by obesity are cardiac ion channels and Ca handling proteins. However, the underlying molecular mechanisms of the impact of obesity on these channels/Ca handling proteins remain incompletely understood. Obesity is marked by accumulation of adipose tissue associated with a variety of adverse adaptations including dyslipidemia (or abnormal levels of serum free fatty acids), increased secretion of pro-inflammatory cytokines, fibrosis, hyperglycemia, and insulin resistance, that will cause electrical remodeling and thus predispose to arrhythmias. Further, adipose tissue is also associated with the accumulation of subcutaneous and visceral fat, which are marked by distinct signaling mechanisms. Thus, there may also be functional differences in the outcome of regional distribution of fat deposits on ion channel/Ca handling proteins expression. Evaluating alterations in their functional expression in obesity will lead to progress in the knowledge about the mechanisms responsible for obesity-related arrhythmias. These advances are likely to reveal new targets for pharmacological modulation. The objective of this article is to review cardiac ion channel/Ca handling proteins remodeling that predispose to arrhythmias. Understanding how obesity and related mechanisms lead to cardiac electrical remodeling is likely to have a significant medical and economic impact.

show abstract

hERG 1a LQT2 C-terminus truncation mutants display hERG 1b-dependent dominant negative mechanisms

Cited by 23 publications

References 22 publications

Development of a High-Throughput Flow Cytometry Assay to Monitor Defective Trafficking and Rescue of Long QT2 Mutant hERG Channels

Development of a High-Throughput Flow Cytometry Assay to Monitor Defective Trafficking and Rescue of Long QT2 Mutant hERG Channels

Expanding the genetic and phenotypic relevance of KCNB1 variants in developmental and epileptic encephalopathies: 27 new patients and overview of the literature

Cardiac Ion Channel Regulation in Obesity and the Metabolic Syndrome: Relevance to Long QT Syndrome and Atrial Fibrillation

Contact Info

Product

Resources

About