Genetic diversity of hepatitis B virus strains isolated in Rio de Janeiro, Brazil

Abstract

Hepatitis B virus (HBV) genomes have been classified into six groups, A-F, group F being the most divergent. South America has provided the smallest number of strains studied at the genome level. The only HBV strain from this region sequenced completely has been classified in group F, and contains the most divergent of the HBV genomes presently known [Naumann et al. (1983): Journal of General Virology 74:1627-1632]. To evaluate genetic relatedness between strains isolated in South America and in the rest of the world, a restriction endonuclease analysis was carried out on 14 HBV strains (4 adw2, 3 adw4, 3 ayw2, and 4 ayw3) isolated in Rio de Janeiro, Brazil. C, pre-S, and X genes along with the 5' part of the P gene from these strains were amplified by the polymerase chain reaction. The DNA fragments were digested by BamHI, BstEII, EcoRI, HhaI, and TaqI endonucleases. The restriction patterns obtained were compared with those deduced from the nucleotide sequence of 26 HBV strains isolated in other continents. The results showed a large genetic variability of Brazilian strains. Taking into account that all the samples examined possessed the w antigenic subdeterminant, the number of different restriction patterns of strains isolated in Rio de Janeiro was at least as large as that of the reference strains isolated in the rest of the world. Some original restriction patterns were found in adw4 and ayw2 HBV strains.

Epidemiology of hepatitis B virus infection among recyclable waste collectors in central Brazil

“…HBsAg-positive samples were assayed for hepatitis B e antigen (HBeAg) and antibodies against HBeAg (anti-HBe) (Eti-Ab-Ebk Plus, Diasorin, Italy). DNA was extracted from HBsAg-and antiHBc-positive samples as previously reported 16 . The pre-S/S genome region was amplifi ed using a semi-nested polymerase chain reaction (PCR) 17 , and the resulting amplicons were genotyped by nucleotide sequence analysis of the S region 18 .…”

Seropositivity for hepatitis B virus, vaccination coverage, and vaccine response in dentists from Campo Grande, Mato Grosso do Sul, Brazil

“…The viral DNA was extracted from serum and amplified as described previously by Niel et al (1994). The oligonucleotides used as primers were: PS1 5'CCATATTCTTGGGAACAAGA3' (nt 2826-2845), PS2 5'GGTCCCCAGTCCTCGAGAAG3' (nt 124-143), X1 5'ACCTCCTTTCCATGGCTGCT3' (nt 1363-1382), X2 5'TAGGCAGAGGTGAAAAAGTT3' (nt 1818-1837), C1 5'CTGTGGAGTTACTCTCGTTTTTGC3 ' (nt 1935-1958), C2 5'CTAACATTGAGATTCCCGAGATTG3' (nt 2432-2458), S2 5'GGGTTTAAATGTATACCCAAA GA3' (nt 841-819), PS4 5'ACACTCATCCTCAGG CCATGCAGTG3' (nt 3194-3218) (Niel et al 1994, Gomes et al 1996. In the first round of amplification, the primer pairs PS1-PS2, X1-X2, C1-C2, C1-PS2, PS1-S2 were used to amplify five HBV fragments.…”

[No Title Available]

“…Detection and genotyping of HBV DNA -DNA was extracted from 250 µl of serum samples, as described elsewhere (Niel et al 1994). PCR was carried out in a final volume of 50 µl in 35 cycles under the following conditions: 95ºC for 30 s, 52ºC for 1 min, 72ºC for 1 min, final elongation at 72ºC for 7 min.…”

“…PCR was carried out in a final volume of 50 µl in 35 cycles under the following conditions: 95ºC for 30 s, 52ºC for 1 min, 72ºC for 1 min, final elongation at 72ºC for 7 min. Four primers pairs were used to amplify HBV fragments which, taken together, encompassed 81% of the genome: PS1-PS2 and X1-X2 (Niel et al 1994), C1-PS2 and PS4-S2 . The PCR products were subjected to RFLP analysis, as previously described by De Castro et al (2000).…”