Generation and validation of homozygous fluorescent knock-in cells using CRISPR–Cas9 genome editing

Koch, Birgit; Nijmeijer, Bianca; Kueblbeck, Moritz; Yin, Chen; Walther, Nike; Ellenberg, Jan

doi:10.1038/nprot.2018.042

Cited by 111 publications

(70 citation statements)

References 48 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…In non-germline cells, the insertion precision by HR is often limited due to the co-existence of alternative repair pathways, and errors such as small indels are frequently observed near one or the other side of the inserted fragment. Therefore, a substantial number of clones need to be screened in order to obtain a few correct ones (Koch et al, 2018). PCR tagging does not generate the perfect clone containing only a seamlessly integrated tag, since it is accompanied by a generic transcription termination site that replaces the endogenous 3'-UTR.…”

Section: Discussionmentioning

confidence: 99%

CRISPR-Cas12a-assisted PCR tagging of mammalian genes

Fueller

Herbst

Meurer

et al. 2018

Preprint

View full text Add to dashboard Cite

AbstractHere we describe a time-efficient strategy for endogenous C-terminal gene tagging in mammalian tissue culture cells. An online platform is used to design two long gene-specific oligonucleotides for PCR with generic template cassettes to create linear dsDNA donors, termed PCR cassettes. PCR cassettes encode the tag (e.g. GFP), a Cas12a CRISPR RNA for cleavage of the target locus and short homology arms for directed integration via homologous recombination. The integrated tag is coupled to a generic terminator shielding the tagged gene from the co-inserted auxiliary sequences. Co-transfection of PCR cassettes with a Cas12a-encoding plasmid leads to robust endogenous expression of tagged genes, with tagging efficiency of up to 20% without selection, and up to 60% when selection markers are used. We used target-enrichment sequencing to investigate all potential sources of artefacts. Our work outlines a quick strategy particularly suitable for exploratory studies using endogenous expression of fluorescent protein tagged genes

show abstract

Section: Discussionmentioning

confidence: 99%

CRISPR-Cas12a-assisted PCR tagging of mammalian genes

Fueller

Herbst

Meurer

et al. 2018

Preprint

View full text Add to dashboard Cite

show abstract

“…Plasmid pHTC-Histone H2B-HaloTag was generated by cloning a PCR fragment of H2B from an existing H2B-GFP plasmid into Nhe1 cloning site of pHCT HaloTag CMV-neo vector (Promega, G7711) generating a C-terminal HaloTag. U2OS cells homozygously expressing Cterminally tagged 53BP1-GFP were generated using CRISPR-Cas9D10A mediated homology-directed repair 28 : cells were transfected with two pX335-U6-Chimeric_BB-CBh-hSpCas9n (D10A) plasmids (Addgene plasmid #42335) 29…”

Section: Ctagaagaccagaaagagggtcgctcaactaataaggaaaatcc U2osmentioning

confidence: 99%

Stabilization of chromatin topology safeguards genome integrity

Ochs

Karemore

Miron

et al. 2019

Nature

149

119

View full text Add to dashboard Cite

To safeguard genome integrity in response to DNA double-strand breaks (DSB), mammalian cells mobilize the neighboring chromatin to shield DNA ends against excessive resection that could undermine repair fidelity and cause damage to healthy chromosomes 1. This form of genome surveillance is orchestrated by 53BP1, whose accumulation at DSBs triggers sequential recruitment of RIF1 and the shieldin-CST-Polα complex 2. How this pathway reflects and impacts on the three-dimensional (3D) nuclear architecture is not known. Here, we applied super-resolution microscopy to show that 53BP1 and RIF1 form an autonomous functional module that stabilizes 3D chromatin topology at sites of DNA breakage. This is initiated by 53BP1 accrual at compact chromatin regions colocalizing with topology-associated domain (TAD) sequences and followed by RIF1 recruitment to boundaries between such domains. The alternating 53BP1 and RIF1 distribution stabilizes several neighboring TAD-sized structures at a single DBS site to an ordered, circular arrangement. Depletion of 53BP1 or RIF1 (but not shieldin) disrupts this arrangement, leading to decompaction of DSBflanking chromatin, reduction of interchromatin space, aberrant spreading of DNA repair proteins, and DNA-end hyper-resection. Similar topological distortions are triggered by depletion of cohesin, suggesting that maintenance of chromatin structure after DNA breakage involves basic mechanisms that shape 3D nuclear organization. Since topological stabilization of DSB-flanking chromatin is independent of DNA repair, we propose that besides providing a structural scaffold to protect DNA ends against aberrant processing, 53BP1 and RIF1 safeguard epigenetic integrity at loci disrupted by DNA breakage. quantitative nanoscopy texture (QUANTEX) analysis tool, which indeed revealed a significant increase in 53BP1-MD Mean breadth and Principal axis length (Fig. 1e, f; Extended Data Fig. 3a-c). It was further reproduced by silencing RIF1 with multiple siRNAs, by replacing endogenous 53BP1 with a mutant unable to promote RIF1 recruitment 10 , and in several cancer-derived as well as non-cancerous cells (Extended Data Fig. 4a-e). Together, these data indicate that 53BP1 and RIF1 form an autonomous module where RIF1 is required to stabilize 53BP1-NDs into ordered, circular chromatin architecture (Extended Data Fig. 4f). In support of this, knockdown of 53BP1 or RIF1 phenocopied each other by disrupting γH2AX-marked chromatin into disordered and elongated shapes (Extended Data Fig. 4g-i). To study how 53BP1 and RIF1 cooperate to stabilize chromatin topology, we set out to determine RIF localization with respect to 53BP1. While conventional microscopy only generally indicates 53BP1 and RIF1 proximity at DSB-sites, 3D-SIM and STED revealed that RIF1 localized to the chromatin boundaries between neighboring 53BP1-NDs (Fig. 2a). To understand the purpose of this alternating localization, we tracked 53BP1 dynamics from pre-to post-damaged state using live-cell 3D-SIM (live-SIM; Extended Data Fig. 5a). The fir...

show abstract

“…U2OS cells expressing C-terminally endogenously tagged proteins of interest were generated using CRISPR-Cas9 mediated homology-directed repair as described 33, 34 . Paired guide RNAs (gRNA) for specified genomic locus (MCM2: guide#1 TAGGGCCTCAGAACTGCTGC and guide#2 GCCATCCATAAGGATTCCTT, MCM4: guide#1 AAGGCTTCAGAGCAAGCGCA and guide#2 CTGCTTGCTGCACGCCACAT, CDC45: guide#1 GCATCAGGGTCGGGCTCTGA and guide#2 GCTCTGTCCTCCCTCAACGG) were inserted into pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A) (Addgene plasmid #42335, a gift from Feng Zhang) via Bbs I restriction site.…”

Section: Methodsmentioning

confidence: 99%

The dynamic equilibrium of nascent and parental MCMs safeguards replicating genomes

Sedláčková

Rask

Choudhary

et al. 2019

Preprint

View full text Add to dashboard Cite

The MCM2-7 (minichromosome maintenance) protein complex is a DNA unwinding motor 25 required for the eukaryotic genome duplication 1 . Although a huge excess of MCM2-7 is 26 loaded onto chromatin in G1 phase to form pre-replication complexes (pre-RCs), only 5-10 27 percent are converted into a productive CDC45-MCM-GINS (CMG) helicase in S phase -a 28 perplexing phenomenon often referred to as the 'MCM paradox' 2 . Remaining pre-RCs stay 29 dormant but can be activated under replication stress (RS) 3 . Remarkably, even a mild 30 reduction in MCM pool results in genome instability 4,5 , underscoring the critical requirement 31 for high-level MCM maintenance to safeguard genome integrity across generations of 32 dividing cells. How this is achieved remains unknown. Here, we show that for daughter cells 33 to sustain error-free DNA replication, their mothers build up a stable nuclear pool of MCMs 34 both by recycling of chromatin-bound MCMs (referred to as parental pool) and synthesizing 35 new MCMs (referred to as nascent pool). We find that MCMBP, a distant MCM paralog 6 , 36 ensures the influx of nascent MCMs to the declining recycled pool, and thereby sustains 37 critical levels of MCMs. MCMBP promotes nuclear translocation of nascent MCM3-7 (but 38 not MCM2), which averts accelerated MCM proteolysis in the cytoplasm, and thereby fosters 39 assembly of licensing-competent nascent MCM2-7 units. Consequently, lack of MCMBP leads 40 to reduction of nascent MCM3-7 subunits in mother cells, which translates to poor MCM 41 inheritance and grossly reduced pre-RCs formation in daughter cells. Unexpectedly, whereas 42 the pre-RC paucity caused by MCMBP deficiency does not alter the overall bulk DNA 43 synthesis, it escalates the speed and asymmetry of individual replisomes. This in turn 44 increases endogenous replication stress and renders cells hypersensitive to replication 45 perturbations. Thus, we propose that surplus of MCMs is required to safeguard replicating 46 genomes by modulating physiological dynamics of fork progression through chromatin 47

show abstract

Generation and validation of homozygous fluorescent knock-in cells using CRISPR–Cas9 genome editing

Cited by 111 publications

References 48 publications

CRISPR-Cas12a-assisted PCR tagging of mammalian genes

CRISPR-Cas12a-assisted PCR tagging of mammalian genes

Stabilization of chromatin topology safeguards genome integrity

The dynamic equilibrium of nascent and parental MCMs safeguards replicating genomes

Contact Info

Product

Resources

About