Gene targeting restricted to mouse striated muscle lineage

Miniou, Pierre; Tiziano, D; Frugier, Tony; Roblot, Natacha; M, Le Meur; Melki, Judith

doi:10.1093/nar/27.19.e27

Cited by 184 publications

(221 citation statements)

References 0 publications

Supporting

Mentioning

212

Contrasting

Order By: Relevance

“…Then, we inactivated E4f1 in vivo in striated muscles by crossing E4f1 −/flox mice with Acta1-Cre transgenic (Tg) mice that express the Cre recombinase under the control of the skeletal α-actin promoter [hereafter referred to as Tg(Acta1-Cre)] (Fig. 3B) (29). We verified the efficiency and the tissular specificity of Cre-driven recombination of the E4f1 flox allele in E4f1 −/flox ; Tg(Acta1-Cre) and E4f1 +/flox ; Tg(Acta1-Cre) control littermates [hereafter referred to as CTL (ACTA) and E4f1 KO(ACTA) , respectively].…”

Section: E4f1 Inactivation Results In Reduced Pdh Activity and Metabolicmentioning

confidence: 99%

E4F1 controls a transcriptional program essential for pyruvate dehydrogenase activity

Lacroix

Rodier

Kirsh

et al. 2016

Proc. Natl. Acad. Sci. U.S.A.

View full text Add to dashboard Cite

The mitochondrial pyruvate dehydrogenase (PDH) complex (PDC) acts as a central metabolic node that mediates pyruvate oxidation and fuels the tricarboxylic acid cycle to meet energy demand. Here, we reveal another level of regulation of the pyruvate oxidation pathway in mammals implicating the E4 transcription factor 1 (E4F1). E4F1 controls a set of four genes [dihydrolipoamide acetlytransferase (Dlat), dihydrolipoyl dehydrogenase (Dld), mitochondrial pyruvate carrier 1 (Mpc1), and solute carrier family 25 member 19 (Slc25a19)] involved in pyruvate oxidation and reported to be individually mutated in human metabolic syndromes. E4F1 dysfunction results in 80% decrease of PDH activity and alterations of pyruvate metabolism. Genetic inactivation of murine E4f1 in striated muscles results in viable animals that show low muscle PDH activity, severe endurance defects, and chronic lactic acidemia, recapitulating some clinical symptoms described in PDC-deficient patients. These phenotypes were attenuated by pharmacological stimulation of PDH or by a ketogenic diet, two treatments used for PDH deficiencies. Taken together, these data identify E4F1 as a master regulator of the PDC.E4F1 | PDH | pyruvate | muscle | endurance

show abstract

Section: E4f1 Inactivation Results In Reduced Pdh Activity and Metabolicmentioning

confidence: 99%

E4F1 controls a transcriptional program essential for pyruvate dehydrogenase activity

Lacroix

Rodier

Kirsh

et al. 2016

Proc. Natl. Acad. Sci. U.S.A.

View full text Add to dashboard Cite

show abstract

“…The -actin skeletal muscle promoter directs expression at the end of gestation and postnatally, specifically in skeletal and cardiac muscle (Brennan & Hardeman 1993, Miniou et al 1999. The Cre transgene was introduced into fertilised oocytes from C57BL6 CBA mice by pronuclear injection.…”

Section: Construction Of -Actin-cre Expression Vector and Transgenic mentioning

confidence: 99%

Threshold effects of glucose transporter-4 (GLUT4) deficiency on cardiac glucose uptake and development of hypertrophy

Kaczmarczyk

Andrikopoulos

Favaloro

et al. 2003

Journal of Molecular Endocrinology

View full text Add to dashboard Cite

The aim of this study was to investigate the metabolic and structural consequences of a decrease in glucose transporter-4 (GLUT4) levels on the heart. The CreLoxP system was utilised to delete GLUT4 in muscle tissue including heart. The presence of the PGK-neoR cassette in the GLUT4-Lox mice resulted in reduced expression in all tissues to levels 15-30% of wild-type control mice. In mice expressing Cre recombinase, there was a further reduction of GLUT4 in cardiac tissue to almost undetectable levels. Cardiac glucose uptake was measured basally and during a euglycaemic/hyperinsulinaemic clamp using 2-deoxy-[1-14 C]glucose. Insulin-stimulated glucose uptake was normal in hearts expressing 15% of normal GLUT4 levels but markedly reduced in mice with more profound reduction in GLUT4. Cardiac enlargement occurred only when GLUT4 levels were less than 5% of normal values. In heart there is a threshold level of GLUT4 above which insulin-stimulated glucose uptake is maintained. As little as 5% of normal GLUT4 levels expressed in heart is sufficient to prevent the development of cardiac hypertrophy.

show abstract

“…Mice were genotyped by PCR using a primer within the neomycin cassette (TGGCTACCCGTGATATTGCT) and a primer within the isl1 locus (GGCTCTCTCCACCACATCGT). Human skeletal actin (HSA)::cre mice have been described previously (Miniou et al, 1999); mice were genotyped by PCR using a primer in the HSA promoter (AAGTGAAGCCTCGCTTCC) and a primer in the cre coding region (CCTCATCACTCGTTGCATCGA). Z/AP mice, carrying a floxed lacZ expression cassette, have been characterized previously (Lobe et al, 1999); the mice were genotyped by PCR using a pair of primers in the hPLAP coding sequence (CCGCTTCCCATATGTGGCTCTGTCC and GCATGA GCTCAGTGCGGTTCCACAC).…”

Section: Methodsmentioning

confidence: 99%

“…To inactivate muscle-derived Nrg-1, we generated mice carrying a HSA::cre transgene and null and loxP-flanked alleles of nrg-1 (HSA::cre; nrg-1 f/Ϫ ). HSA::cre mice express Cre recombinase selectively in somites as early as E9.5, and by P0, Cre-mediated inactivation of loxP-flanked alleles in skeletal muscle has been described as efficient and uniform among muscles (Miniou et al, 1999). To quantitate how effectively loxP-flanked sequences are deleted in skeletal muscle of HSA::cre mice, we crossed HSA::cre mice with Z/AP reporter mice (Lobe et al, 1999).…”

Section: Quantitation Of Cre-mediated Deletion Of Loxp-flanked Sequenmentioning

confidence: 99%

Neuromuscular Synapse Formation in Mice Lacking Motor Neuron- and Skeletal Muscle-Derived Neuregulin-1

Jaworski

Burden²

2006

J. Neurosci.

View full text Add to dashboard Cite

The localization of acetylcholine receptors (AChRs) to the vertebrate neuromuscular junction is mediated, in part, through selective transcription of AChR subunit genes in myofiber subsynaptic nuclei. Agrin and the muscle-specific receptor tyrosine kinase, MuSK, have critical roles in synapse-specific transcription, because AChR genes are expressed uniformly in mice lacking either agrin or MuSK. Several lines of evidence suggest that agrin and MuSK stimulate synapse-specific transcription indirectly by regulating the distribution of other cell surface ligands, which stimulate a pathway for synapse-specific gene expression. This putative secondary signal for directing AChR gene expression to synapses is not known, but Neuregulin-1 (Nrg-1), primarily based on its presence at synapses and its ability to induce AChR gene expression in vitro, has been considered a good candidate. To study the role of Nrg-1 at neuromuscular synapses, we inactivated nrg-1 in motor neurons, skeletal muscle, or both cell types, using mice that express Cre recombinase selectively in developing motor neurons or in developing skeletal myofibers. We find that AChRs are clustered at synapses and that synapse-specific transcription is normal in mice lacking Nrg-1 in motor neurons, myofibers, or both cell types. These data indicate that Nrg-1 is dispensable for clustering AChRs and activating AChR genes in subsynaptic nuclei during development and suggest that these aspects of postsynaptic differentiation are dependent on Agrin/MuSK signaling without a requirement for a secondary signal.

show abstract

Gene targeting restricted to mouse striated muscle lineage

Cited by 184 publications

References 0 publications

E4F1 controls a transcriptional program essential for pyruvate dehydrogenase activity

E4F1 controls a transcriptional program essential for pyruvate dehydrogenase activity

Threshold effects of glucose transporter-4 (GLUT4) deficiency on cardiac glucose uptake and development of hypertrophy

Neuromuscular Synapse Formation in Mice Lacking Motor Neuron- and Skeletal Muscle-Derived Neuregulin-1

Contact Info

Product

Resources

About