Gene Polymorphisms in CCR5, CCR2, CX3CR1, SDF-1 and RANTES in Exposed but Uninfected Partners of HIV-1 Infected Individuals in North India

Abstract

Repeated exposure to human immunodeficiency virus (HIV) does not always result in infection. Understanding the mechanisms that give protection against progressive infection with HIV may help in the development of a vaccine. In order to determine the influence of host genetic factors on HIV resistance, we studied 35 exposed but uninfected (EU) partners of HIV-1 infected individuals for polymorphisms in multiple chemokine and chemokine receptor genes and compared the results with those for 75 HIV-1 seronegative normal healthy controls (HC) and 50 HIV infected controls. There was no association between CCR5-Delta32, CCR2-64I, CX3CR1-280 M, CX3CR1-249I, SDF-3'A, RANTES-28G and RANTES-403A polymorphisms and susceptibility against HIV in our cohort of EU individuals. An increased frequency of SDF-1 3'A and RANTES-403A genotypes was present in EU individuals but the difference was not statistically significant when compared to healthy and HIV infected controls. These observations suggest that mechanisms other than genetic mutations of these genes might be responsible for resistance to HIV infection in these individuals.

Human Immunodeficiency Virus (HIV) gag Antigen-Specific T-Helper and Granule-Dependent CD8 T-Cell Activities in Exposed but Uninfected Heterosexual Partners of HIV Type 1-Infected Individuals in North India

“…Our earlier analysis of chemokines and their receptor gene polymorphisms did not show any significant association (35). However, there was elevated spontaneous and HIV gag p24 antigen-induced production of beta chemokines (regulated on activation, normal T-cell-expressed and secreted protein [RANTES], macrophage inflammatory protein 1␣ [MIP-1␣], and MIP-1␤) but not alpha chemokine (stromal cell derived factor 1) by PBMCs in these individuals (36).…”

The effect of combined polymorphisms in chemokines and chemokine receptors on the clinical course of HIV-1 infection in a Brazilian population

“…The 380 bp products were subjected to RFLP with the restriction enzyme BseGI, generating two fragments (215 and 165 bp) only when the mutation corresponding to CCR2-64I was present. The wild type allele remained uncut (Suresh et al 2006). For the CCR5 promoter region, primers 5'AAAATCCCCACTAAGATCCTG3' and 5'ATTCATCTAGTCAAAAGCCCAC3' were used .…”

Increased Activity of NK Cells and Plasmacytoid Dendritic Cells in HIV-Exposed Seronegative (ESN) Individuals

“…We had earlier reported that Human immunodeficiency virus (HIV) gag antigen-specific T-helper and granule-dependent CD8 T-cell have enhanced activities in exposed but uninfected (ESN) heterosexual partners of HIV type 1-infected individuals in North India [6]. Further we tried to explore the association of gene polymorphisms in CCR5, CCR2, CX3CR1, SDF-1 and RANTES to protection in these individuals [7], but the role of cellular innate immune components remained unexplored. The innate immune system is composed of a wide variety of cellular components including NK cells and dendritic cells which play a significant role in preventing the infection by pathogens.…”

“…The innate immune system is composed of a wide variety of cellular components including NK cells and dendritic cells which play a significant role in preventing the infection by pathogens. Natural killer (NK) cells, which account for about 10% of peripheral blood lymphocytes, are very effective in producing cytokines like IFNγ, TNFα and GM-CSF which are important regulators of immune responses and haematopoiesis and link the innate to the adaptive immune response through a bidirectional cross-talk with 7 dendritic cells [8,9]. Although low numbers of NK cells have been shown to be associated with rapid progression to AIDS in HIV-infected individuals [10], their role in protection against the establishment of HIV-1 infection remains to be fully elucidated.…”