Galectin-1 and galectin-3: Plausible tumour markers for oral squamous cell carcinoma and suitable targets for screening high-risk population

Dynamics of regulatory T cells (Tregs) in patients with oral squamous cell carcinoma

“…RNA was isolated from 17 tumor biopsies from tumor and nontumor areas as described earlier . Briefly, homogenized biopsy samples were processed using ONE STEP RNA REAGENT (Biobasic, Inc., Ontario, Canada) as per manufacturer's instructions.…”

“…Real‐time PCR (qRT‐PCR) was performed using specific primers (β Actin:For‐ 5′‐GCACAGAGCCTCGCCTT‐3′, Rev‐ 5′‐CCTTGCACATGCCGGAG‐3′; GAP‐DH: For‐ 5′‐GAAGGTGAAGGTCGGAGTCA‐3′, Rev‐ 5′‐TTGAGGTCAATGAAGGGGTC‐3′; α Tubulin: For‐ 5′‐GCAACAACCTCTCCTCTTCG‐3′, Rev‐ 5′‐CATTGCCAATCTGGACACC‐3′; TGF‐β: For‐ 5′‐GCAGAAGTTGGCATGGTAGC‐3′, Rev‐ 5′‐CCCTGGACACCAACTATTGC‐3′; CCL‐5: For‐ 5′‐ CTGCTGCTTTGCCTACATTG‐3′, Rev‐ 5′‐TTTCTTCTCTGGGTTGGCAC‐3′; CCL‐19: For‐ 5′‐ACACAGATCCTGCACACACC‐3′, Rev‐ 5′‐CATCATTGGTGCCACTCAGA‐3′; CCL‐21: For‐ 5′‐CCTTATCCTGGTTCTGGCCT‐3′, Rev‐ 5′‐CAGCCTAAGCTTGGTTCCTG‐3′) in a CFX96 Touch™ Real‐Time PCR Detection System (Bio‐Rad Laboratories, Hercules, CA) and a Maxima SYBR Green/ROX qPCR Master Mix (Thermo Fisher Scientific) as described elsewhere . The reactions were initiated with 1 µL of cDNA, 0.5 µM of each primer and reaction mix in a final volume of 10 µL.…”

Thiodigalactoside shows antitumour activity by beta‐galactoside‐binding protein and regulatory T cells inhibition in oral squamous cell carcinoma

“…Hence, it has been reported to be the potential target for antitumour immunotherapies. We also reported a biphasic regulation of oral cancer cells by β ‐GBP, whereas its role in oral carcinogenesis has not been clearly defined (Aggarwal et al , ).…”

“…‘E’ represents the effector cells, that is T reg cells, and ‘T’ indicate test cells, which are the tumour cell lines. The viability of cells after the treatment was observed by performing MTT assay as discussed earlier (Aggarwal and Das, ; Aggarwal et al , ). We also observed their effects on the growth of oral cancer cell lines when treated with β ‐GBP or T reg alone and in combination.…”

“…We have earlier reported the overexpression of β ‐galactoside‐binding protein ( β ‐GBP) or galectin‐1 in OSCC patients and oral cancer cell lines (Aggarwal et al , ). Likewise, its upregulation has been observed in many other primary and metastatic tumours (Sakaki et al , ; Zhong et al , ; Song et al , ).…”