G-quadruplex formation by single-base mutation or deletion of mitochondrial DNA sequences

Chu, I-Te; Wu, Cheng‐Lung; Chang, Ta‐Chau

doi:10.1016/j.bbagen.2018.11.009

Cited by 8 publications

(25 citation statements)

References 24 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Previously, we found that mt10251 sequence without flanking nucleotides can form intramolecular WC hydrogen bonds in 10 mM Tris. After the addition of 20 mM K + , the intermolecular G4 formation was much more dominated than the intramolecular G4 formation [24]. Here NMR results show that the intramolecular WC hydrogen bonds in a native mt10248 sequence is negligible in 10 mM Tris.…”

Section: Effects Of Potassium Concentration On (G 3 Hg 3 N M G 3 Hg 3mentioning

confidence: 68%

“…In addition, PAGE results show that a large portion of non-G4 residues are detected in 20 mM K + solution but are almost negligible in 100 mM K + solution. The study of numerous single-base mutants of 10251 indicated that the third G-tract is involved in hairpin formation with three consecutive C-bases [24,35]. Considering similar population of monomeric G4 formation of 10248 in 20 mM K + and in 100 mM K + solution, such hairpin formation must be unfolded for monomeric G4 formation (Figure 1c).…”

Section: Effects Of Potassium Concentration On (G 3 Hg 3 N M G 3 Hg 3mentioning

confidence: 97%

“…Given that the third G-tract of G24−G26 may be involved in hairpin formation of mt10251 in 10 mM Tris [24], we examined whether a native sequence, CCAG 3 TG 3 AGTAGTTCCCTG CTAAG 3 AG 3 TAG (mt10248), which simply adds native flanking nucleotides to the mt10251 sequence with 5 -CCA and TAG-3 at two ends, could form a monomeric G4 structure. The NMR spectra of mt10248 showed very weak signals near 13 ppm in 10 mM Tris, implying that hairpin formation is almost negligible.…”

Section: Effect Of Flanking Nucleotides On G4 Formation Of Mt10251-fnmentioning

confidence: 99%

“…The findings that the (G 3 HG 3 N m G 3 HG 3 ) sequences without four consecutive G-bases favor to form multimeric G4 structures and the (G 3 HG 3 N m G 3 HG 3 )-FN sequences tend to form monomeric G4 structures can be applied to native G-rich sequences, such as mt10248 [24], Pu22 [25], GTERT [28], and PIG4 [29]. In addition, conformational change from a monomeric G4 formation to a multimeric G4 formation is detected in T4T and T4T-3 after the addition of 100 mM K + .…”

Section: Implication To Native Sequencesmentioning

confidence: 99%

“…Previously, we found the structural diversity of a mitochondrial sequence mt10251 (G 3 TG 3 AGTAGTTCCCTGCTAAG 3 AG 3 ), including the coexistence of a hairpin structure and monomeric, dimeric, and tetrameric G4 structures in 20 mM K + solution. Moreover, a single-base mutation of mt10251 could cause significant changes in terms of structural populations and polymorphism [24]. Particularly, most single-base mutated sequences of mt10251 favor dimeric G4 formation in the absence of hairpin formation.…”

Section: Introductionmentioning

confidence: 99%

See 4 more Smart Citations

Effects of Length and Loop Composition on Structural Diversity and Similarity of (G3TG3NmG3TG3) G-Quadruplexes

Chu

Yeh

et al. 2020

Molecules

Self Cite

View full text Add to dashboard Cite

A G-rich sequence containing three loops to connect four G-tracts with each ≥2 guanines can possibly form G-quadruplex structures. Given that all G-quadruplex structures comprise the stacking of G-quartets, the loop sequence plays a major role on their folding topology and thermal stability. Here circular dichroism, NMR, and PAGE are used to study the effect of loop length and base composition in the middle loop, and a single base difference in loop 1 and 3 on G-quadruplex formation of (G3HG3NmG3HG3) sequences with and without flanking nucleotides, where H is T, A, or C and N is T, A, C, or G. In addition, melting curve for G-quadruplex unfolding was used to provide relatively thermal stability of G-quadruplex structure after the addition of K+ overnight. We further studied the effects of K+ concentration on their stability and found structural changes in several sequences. Such (G3HG3NmG3HG3) configuration can be found in a number of native DNA sequences. The study of structural diversity and similarity from these sequences may allow us to establish the correlation between model sequences and native sequences. Moreover, several sequences upon interaction with a G-quadruplex ligand, BMVC, show similar spectral change, implying that structural similarity is crucial for drug development.

show abstract

Section: Effects Of Potassium Concentration On (G 3 Hg 3 N M G 3 Hg 3mentioning

confidence: 68%

Section: Effects Of Potassium Concentration On (G 3 Hg 3 N M G 3 Hg 3mentioning

confidence: 97%

Section: Effect Of Flanking Nucleotides On G4 Formation Of Mt10251-fnmentioning

confidence: 99%

Section: Implication To Native Sequencesmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 3 more Smart Citations

Effects of Length and Loop Composition on Structural Diversity and Similarity of (G3TG3NmG3TG3) G-Quadruplexes

Chu

Yeh

et al. 2020

Molecules

Self Cite

View full text Add to dashboard Cite

show abstract

Refining our methodologies for assessing quadruplex DNA ligands; selectivity or an illusion of selectivity?

Oskouie

Abiri

2021

Analytical Biochemistry

View full text Add to dashboard Cite

Comparison and Elucidation of Structural Diversity and Variation of G-Rich Sequences with a Single G-Base Difference

2019

Self Cite

View full text Add to dashboard Cite

Previously, we found the structural diversity of a mitochondrial sequence mt10251 (GGGTGGGAGTAGTTCCCTGCTAAGGGAGGG), including coexistence of a hairpin structure and monomeric, dimeric, and tetrameric G4 structures in 20 mM K+ solution. Moreover, a single-base mutation of mt10251 could cause significant changes in terms of structural populations and polymorphism. In this work, we investigate the diverse G4 topologies of mt10251 and structural variation of its mutants. Using circular dichroism (CD), nuclear magnetic resonance (NMR), and polyacrylamide gel electrophoresis (PAGE), we first illustrate an unusual tetrameric G4 structure together with hairpin bulges formed by four strands of mt10251-d30 (GGGTGGGAGTAGTTCCCTGCTAAGGGAGG). Of interest is that the structural conversion from a hairpin structure to diverse G4 structures in mt10251 is negligible in mt10251-d30 after the addition of 20 mM K+. Further kinetic and thermal studies of mt10251, mt10251-d30, and their mutants reveal the major factors in determining the transition from a hairpin structure to diverse G4 structures of mt10251 and the structural variation of their mutants after the addition of 20 mM K+.

show abstract

G-quadruplex formation by single-base mutation or deletion of mitochondrial DNA sequences

Cited by 8 publications

References 24 publications

Effects of Length and Loop Composition on Structural Diversity and Similarity of (G3TG3NmG3TG3) G-Quadruplexes

Effects of Length and Loop Composition on Structural Diversity and Similarity of (G3TG3NmG3TG3) G-Quadruplexes

Refining our methodologies for assessing quadruplex DNA ligands; selectivity or an illusion of selectivity?

Comparison and Elucidation of Structural Diversity and Variation of G-Rich Sequences with a Single G-Base Difference

Contact Info

Product

Resources

About