Functional Redundancy of Variant and Canonical Histone H3 Lysine 9 Modification in Drosophila

Abstract

Histone post-translational modifications (PTMs) and differential incorporation of variant and canonical histones into chromatin are central modes of epigenetic regulation. Despite similar protein sequences, histone variants are enriched for different suites of PTMs compared to their canonical counterparts. For example, variant histone H3.3 occurs primarily in transcribed regions and is enriched for "active" histone PTMs like Lys9 acetylation (H3.3K9ac), whereas the canonical histone H3 is enriched for Lys9 methylation (H3K9me), which is found in transcriptionally silent heterochromatin. To determine the functions of K9 modification on variant canonical H3, we compared the phenotypes caused by engineering and mutant genotypes in Whereas most , and a small number of , mutant animals are capable of completing development and do not have substantially altered protein-coding transcriptomes, all combined mutants die soon after embryogenesis and display decreased expression of genes enriched for K9ac. These data suggest that the role of K9ac in gene activation during development can be provided by either H3 or H3.3. Conversely, we found that H3.3K9 is methylated at telomeric transposons and that this mark contributes to repressive chromatin architecture, supporting a role for H3.3 in heterochromatin that is distinct from that of H3. Thus, our genetic and molecular analyses demonstrate that K9 modification of variant and canonical H3 have overlapping roles in development and transcriptional regulation, though to differing extents in euchromatin and heterochromatin.

Lysine 27 of replication-independent histone H3.3 is required for Polycomb target gene silencing but not for gene activation

“…To further explore potential male-specific functions of H3.3B lysine 27, we introduced a transgene containing the wild type H3 . 3B gene onto chromosome three [47] ( Fig 3D ). The additional wild type copy of H3.3B fully rescued viability of H3.3B K27R males ( Fig 3E ).…”

“…Mutagenesis was performed essentially as described previously [47]. Briefly, the H3.3B lysine 27 to arginine substitution was made using a single gRNA (TGCCCGTAAGTCGACCGGAGGAAAGG) inserted into pCFD3 .…”

Sex-specific phenotypes of histone H4 point mutants establish dosage compensation as the critical function of H4K16 acetylation in Drosophila

“…Previous studies that investigated the function of histone H3 modifications by histone replacement genetics showed that for modifications associated with transcriptionally active chromatin it is essential to remove not only the wild-type copies of the canonical histone genes but to also mutate the histone H3.3 variants (23, 24). The analyses of H4K16R , H4K16Q , and H4K16A mutant phenotypes reported here were all performed in the genetic background of animals lacking His4r, the only histone H4 variant in Drosophila .…”

Rapid embryonic cell cycles defer the establishment of heterochromatin by Eggless/SetDB1 in Drosophila

“…Currently >150 distinct genetic loci are reported to impact PEV, highlighting the complexity of heterochromatin control. Critically, the pathway depositing H3K9me2/3-HP1a forms the regulatory core and null mutations in Su(var) 2-5 (HP1a), and replacement of H3K9 with arginine (H3K9R) to block its modification is lethal (Eissenberg et al 1990;Penke et al 2016Penke et al , 2018. The Drosophila genome encodes three K9 methyltransferases-Su(var)3-9, eggless/SetDB1, and G9a-and all three have been reported to modify PEV (Mis et al 2006;Brower-Toland et al 2009).…”