Functional characterization of two paralogs that are novel RNA binding proteins influencing mitochondrial transcripts of Trypanosoma brucei

Abstract

A majority of Trypanosoma brucei proteins have unknown functions, a consequence of its independent evolutionary history within the order Kinetoplastida that allowed for the emergence of several unique biological properties. Among these is RNA editing, needed for expression of mitochondrial-encoded genes. The recently discovered mitochondrial RNA binding complex 1 (MRB1) is composed of proteins with several functions in processing organellar RNA. We characterize two MRB1 subunits, referred to herein as MRB8170 and MRB4160, which are paralogs arisen from a large chromosome duplication occurring only in T. brucei. As with many other MRB1 proteins, both have no recognizable domains, motifs, or orthologs outside the order. We show that they are both novel RNA binding proteins, possibly representing a new class of these proteins. They associate with a similar subset of MRB1 subunits but not directly with each other. We generated cell lines that either individually or simultaneously target the mRNAs encoding both proteins using RNAi. Their dual silencing results in a differential effect on moderately and pan-edited RNAs, suggesting a possible functional separation of the two proteins. Cell growth persists upon RNAi silencing of each protein individually in contrast to the dual knockdown. Yet, their apparent redundancy in terms of cell viability is at odds with the finding that only one of these knockdowns results in the general degradation of pan-edited RNAs. While MRB8170 and MRB4160 share a considerable degree of conservation, our results suggest that their recent sequence divergence has led to them influencing mitochondrial mRNAs to differing degrees.

Integrity of the core mitochondrial RNA-binding complex 1 is vital for trypanosome RNA editing

“…Taken together, these data indicate that MRB1 core integrity is dependent on subunits such as MRB8620 and MRB11870 , whereas the presence of the GAP1/2 heterotetramer is dispensable for its assembly or stability and even its association with TbRGG2. This finding plus the heterodispersion of the GAP1/2 subcomplex in density gradients (Acestor et al 2009;Hashimi et al 2009;Ammerman et al 2011Ammerman et al , 2012Kafková et al 2012;Aphasizheva et al 2014) and the association of GAP1/2 with REH2 (Madina et al 2014) or TbRGG3 (McAdams et al 2015 suggest that GAP1/2 interactions are not restricted to the MRB1 core and that the heterotetramer represents a functionally distinct entity.…”

“…MRB8620 has been shown to interact with the MRB1 core complex and the TbRGG2 subcomplex by yeast two-hybrid analysis and various tandem affinity purification (TAPs) of tagged MRB1 subunits Weng et al 2008;Hernandez et al 2010;Ammerman et al 2011Ammerman et al , 2012Kafková et al 2012). To confirm that MRB8620 is an integral component of the MRB1 complex, we analyzed proteins copurifying with the C-terminally PTP-tagged MRB8620 without nuclease treatment by LC-MS/MS mass spectroscopy.…”

“…This phenomenon may in part be due to the subcomplex containing TbRGG2 and one of the two highly similar paralogs MRB8170 and MRB4160, all of which bind RNA (Fisk et al 2008;Kafková et al 2012). The TbRGG2 subcomplex also contains a protein called MRB8180 , whose RNA-binding properties and functional analysis have still not been addressed.…”

“…The TbRGG2 subcomplex also contains a protein called MRB8180 , whose RNA-binding properties and functional analysis have still not been addressed. RNAi silencing of the subcomplex primarily impacts pan-edited mRNAs (Fisk et al 2008;Ammerman et al 2010;Kafková et al 2012), leading to the view that they are specific for transcripts requiring multiple gRNAs for their processing . The finding that TbRGG2 has RNA annealing and unwinding activities is consistent with this notion.…”

Trypanosome Letm1 Protein Is Essential for Mitochondrial Potassium Homeostasis

“…The full ORF of HsLetm1 was PCR-amplified from cDNA (clone FLJ81927AAAF) supplied by the National Institute of Technology and Evaluation Biological Resource Center (Japan) using the forward primer TCAGATCTGCTCTTCACCTCTGCGA and reverse primer TCAGATCTTTGCTTCATGGC GTTGA and cloned into the pABPURO vector (43) via the underlined BglII restriction sites. We took advantage of every mRNA bearing a spliced leader RNA sequence by amplifying the 5Ј-end of Letm1 with the canonical spliced leader RNA forward primer and the reverse primer AGACATTAAACGGCCCTTCC, as described previously (44).…”