Feline Polycystic Kidney Disease Mutation Identified in PKD1

Abstract

Abstract. Autosomal dominant polycystic kidney disease (AD-PKD) is a commonly inherited disorder in humans that causes the formation of fluid-filled renal cysts, often leading to renal failure. PKD1 mutations cause 85% of ADPKD. Feline PKD is autosomal dominant and has clinical presentations similar to humans. PKD affects~38% of Persian cats worldwide, which is~6% of cats, making it the most prominent inherited feline disease. Previous analyses have shown significant linkage between the PKD phenotype and microsatellite markers linked to the feline homolog for PKD1. In this report, the feline PKD1 gene was scanned for causative mutations and a CϾA transversion was identified at c.10063 (human ref NM_000296) in exon 29, resulting in a stop mutation at position 3284, which suggests a loss of~25% of the C-terminus of the protein. The same mutation has not been identified in humans, although similar regions of the protein are truncated. The CϾA transversion has been identified in the heterozygous state in 48 affected cats examined, including 41 Persians, a Siamese, and several other breeds that have been known to outcross with Persians. In addition, the mutation is segregating concordantly in all available PKD families. No unaffected cats have been identified with the mutation. No homozygous cats have been identified, supporting the suggestion that the mutation is embryonic lethal. These data suggest that the stop mutation causes feline PKD, providing a test to identify cats that will develop PKD and demonstrating that the domestic cat is an ideal model for human PKD.Companion animal species such as the domestic cat are effective models for several inherited diseases. Cats and humans show strong conservation of biology and anatomy and share Ͼ30 homologous hereditary diseases (1,2). One inherited disease for which the cat is an exceptional animal model is polycystic kidney disease.Autosomal dominant polycystic kidney disease (ADPKD) is a commonly inherited disorder in humans, with a frequency in the general population of 1 in 1000 (3). Approximately 85% of ADPKD cases are caused by mutations in the PKD1 gene (4,5), located on human chromosome 16p13.3; the remaining 15% are caused by mutations in the PKD2 gene, located on human chromosome 4q21-23 (6,7). ADPKD is characterized by the formation of fluid-filled cysts in the kidneys, and the average age of onset is 40 yr, with ESRD occurring by age 60 in 50% of cases (8). This suggests that~4% of ESRD patients are a result of PKD.Feline polycystic kidney disease is an inherited disease in Persian and Persian-related cats. PKD in cats is characterized by renal as well as hepatic and pancreatic cysts (9) and has an autosomal dominant mode of inheritance (10,11). Approximately 38% of Persian cats in the United States (12) and worldwide (13-17) are positive for PKD. Purebred cats represent~20% of the cat population in the United States, and Persian-type breeds constitute 80% of the cat fancy; hence, PKD is the most prominent inherited feline disease.A linkage analysis for feli...

‘I can haz genomes’: cats claw their way into genetics

“…In 2004, a team led by geneticist Leslie Lyons of the University of Missouri in Columbia (and owner of two female cats, Withers and Figaro) discovered that mutations that cause polycystic kidney disease -a major cause of renal failure in older individualsoccur in the same gene in humans and cats 4 . Cat versions of type 2 diabetes, asthma, retinal atrophy and numerous other conditions have close similarities to human disease.…”

Touchdown polymerase chain reaction detection of polycystic kidney disease and laboratory findings in different cat populations

“…As a confirmatory PCR test for the mutation detected via the touchdown PCR protocol, a restriction fragment length polymorphism (RFLP) PCR was performed as previously described, 12 using PKD1F (CAGGTAGACGGGATA GACGA) and PKD1R (TTCTTCCTGGTCAACGACTG) primers, in all of the samples that had tested positive for the PKD1 mutant gene. The final amplification product for exon 29 was 559 bp in all samples.…”

“…This mutation results in a stop codon at position 3284, which corresponds to a loss of 25% of the C-terminus of the polycystin-1 protein, and this form of the protein is a target for molecular detection in ADPKD carriers. 12 Polycystin-1 is responsible for regulating cell proliferation, cell differentiation, and apoptosis, and when its activity is reduced, lesions and cellular changes in the renal parenchyma occur more often. 2 Prevalence studies of this illness suggest high incidences in the United States, Australia, England, Germany, France, and Italy.…”

“…Most research uses groups of purebred cats, and approximately 80% of breeds have some genetic influence from the Persian lineage, 12 including mixed breeds. There is a concern in testing all cats because ADPKD prevalence differs in each breed, and there is, to date, no data published on mixed-breed cats.…”

Polycystic Kidney Disease in Adult Brazilian Agoutis (Dasyprocta leporina)

“…25 Similar to the human form, a mutation on the PKD1 gene causes the majority of adult PKD in cats 13,19 whereas autosomal-dominant PKD in Bull Terriers is likely not associated with a mutation in the canine PKD1 or PKD2 genes. 22,23 Similar alterations are also reported in adult ferrets 6,28 and horses 1,5,29 but the genetic background in these species is unknown.…”